Moon of Alabama Brecht quote
March 13, 2020

News-Nugget About The Coronavirus Pandemic

Excerpts from three current pieces about the novel coronavirus pandemic.

NPR: White House Knew Coronavirus Would Be A 'Major Threat' — But Response Fell Short

In the case of Alex Azar, [the head of Health and Human Services], he did go to the president in January. He did push past resistance from the president's political aides to warn the president the new coronavirus could be a major problem. There were aides around Trump - Kellyanne Conway had some skepticism at times that this was something that needed to be a presidential priority.

But at the same time, Secretary Azar has not always given the president the worst-case scenario of what could happen. My understanding is he did not push to do aggressive additional testing in recent weeks, and that's partly because more testing might have led to more cases being discovered of coronavirus outbreak, and the president had made clear - the lower the numbers on coronavirus, the better for the president, the better for his potential reelection this fall.

So how did that worst-case scenario look?

NYT: The Worst-Case Estimate for U.S. Coronavirus Deaths

Officials at the U.S. Centers for Disease Control and Prevention and epidemic experts from universities around the world conferred last month about what might happen if the new coronavirus gained a foothold in the United States. How many people might die? How many would be infected and need hospitalization?

One of the agency’s top disease modelers, Matthew Biggerstaff, presented the group on the phone call with four possible scenarios — A, B, C and D — based on characteristics of the virus, including estimates of how transmissible it is and the severity of the illness it can cause. The assumptions, reviewed by The New York Times, were shared with about 50 expert teams to model how the virus could tear through the population — and what might stop it.
...
Between 160 million and 214 million people in the U.S. could be infected over the course of the epidemic, according to one projection. That could last months or even over a year, with infections concentrated in shorter periods, staggered across time in different communities, experts said. As many as 200,000 to 1.7 million people could die.

And, the calculations based on the C.D.C.’s scenarios suggested, 2.4 million to 21 million people in the U.S. could require hospitalization, potentially crushing the nation’s medical system, which has only about 925,000 staffed hospital beds. Fewer than a tenth of those are for people who are critically ill.

That is why we argued that only an early and lasting lockdown can prevent that the health care system goes into overload and that many people who would ordinarily survive would otherwise unnecessarily die.

A U.S. op-ed writer, who was in China during the lockdown, repeats our criticism of the racism that led to the still sluggish response in 'western' countries.

NYT: China Bought the West Time. The West Squandered It.

[F]or weeks now, the attitude toward the coronavirus outbreak in the United States and much of Europe has been bizarrely reactive, if not outright passive — or that the governments in those regions have let pass their best chance to contain the virus’s spread. Having seen a kind of initial denial play out already in China, I feel a sense of déjà vu. But while China had to contend with a nasty, sudden surprise, governments in the West have been on notice for weeks.

It’s as if China’s experience hadn’t given Western countries a warning of the perils of inaction. Instead, many governments seem to have imitated some of the worst measures China put in place, while often turning a blind eye to the best of them, or its successes.
...
In my experience living in China for weeks during the peak period of the lockdown and talking to various groups beyond the disgruntled elites, people were frustrated, even exasperated, by the containment measures — but they largely supported them, too.

And while some in the West fixated on how China’s system failed to stem the outbreak at first, they were ignoring the aspects of it that worked. There’s nothing authoritarian about checking temperatures at airports, enforcing social distancing or offering free medical care to anyone with Covid-19.

Your host is currently working on a piece about the social, political and geopolitical consequences the pandemic is likely to have. My first outline says that these will be huge and will reverb over several decades. I will have to tone that down.

---
Previous Moon of Alabama posts on the issue:

Posted by b on March 13, 2020 at 14:00 UTC | Permalink

Comments
« previous page | next page »

So now Trump has declared the coronavirus a US national emergency and offered $50 billion for support of state and local governments to fight the virus with FEMA.

At the same time the US Fed has increased its public support of the global private banking system in amounts looking to total in the trillions of dollars and our Congress Critters are setting up to re-authorize the Patriot Act suppression of human rights.

Just so folks understand the priorities of Hand, The Invisible.

Posted by: psychohistorian | Mar 13 2020 20:02 utc | 101

@8 Davis

Thanks, Mark Davis, for that brilliant take on yourself!

Posted by: Nemesiscalling | Mar 13 2020 20:07 utc | 102

@Siotu #38
False positives are a lot better than false negatives...

Posted by: c1ue | Mar 13 2020 20:09 utc | 103

Here come the excuses,

Health

The 4 Key Reasons the U.S. Is So Behind on Coronavirus Testing

Bureaucracy, equipment shortages, an unwillingness to share, and failed leadership doomed the American response to COVID-19.

Excuses via ATLANTIC

Posted by: Tom_LX | Mar 13 2020 20:10 utc | 104

It apparently needs repeating, but even knowing full well that CV is a deliberate bioweapon attack by the United States, the Chinese will not bluntly and openly assert that the virus is an attack and that they know it.

Even if the Chinese had incontrovertible proof (which they likely do have) that the coronavirus was manufactured; even if they found the copyright notice encoded directly in the nucleotide sequence of the virus, they will not be claiming that it was a deliberate attack. First, that is not remotely how the Chinese think. They strongly believe in giving even their most villainous enemies an "out". They give their opponents the opportunity to back down while saving face. Their stating the virus came from the US but that its release may have been accidental is actually an extraordinarily strong accusation by Chinese standards. It is not going to get any more direct than that, regardless of the proof.

Second, a direct confrontation with the US on this attack means war. Not only is China currently on their back foot and not in the best position to launch a kinetic war due to the viral attack, they are still hoping to better prepare their military so that they can have more control over the progress of the conflict. That is important to the Chinese because they know the US likes killing civilians and destroying infrastructure in order to "Shock and Awe" their targets, as this bioweapon attack clearly demonstrates. The Chinese would like the ability to steer the conflict so that the US doesn't get many opportunities to do that "Shock and Awe" on their civilians, and they are not there yet.

Finally, this attack was almost certainly not a US military operation. The risks of blowback and collateral damage that many posters refer to as arguments against using such a weapon are risks that the military would definitely consider and calculate, and doubtless they would act on those calculations exactly as everyone expects and refuse to use such a weapon. The CIA, on the other hand, are not so inhibited and "squeamish". On the contrary, they revel in the suffering of others, even if those doing the suffering are nominally "on their side".

Posted by: William Gruff | Mar 13 2020 20:10 utc | 105

Listening to Trump and US establishment, setting up test centres at Walmart, caring etc more than you can say about well all EU states!

Posted by: Zanon | Mar 13 2020 20:11 utc | 106

Any specialist view on Johnson's theory ref the herd? How does that work on an island?
https://edition.cnn.com/2020/03/13/uk/uk-coronavirus-response-boris-johnson-intl-gbr/index.html

Posted by: Mina | Mar 13 2020 20:13 utc | 107

William Gruff | Mar 13 2020 20:10 utc | 105 The microbiologist cat @ sake (see above) would seem to agree. So do I, but he's 'sposed to be an expert. MB dud says the cia boys were crazy...

Posted by: Walter | Mar 13 2020 20:16 utc | 108

Pollution in northern Italy
http://www.esa.int/ESA_Multimedia/Videos/2020/03/Coronavirus_nitrogen_dioxide_emissions_drop_over_Italy

how does that compare with India and China?

Posted by: Mina | Mar 13 2020 20:22 utc | 109

William Gruff

You assume that the bug is a bioweapon with no vaccine. Fatality rates amongst five-eyes, US in particular will tell us whether or not a vaccine had been developed.

Posted by: Peter AU1 | Mar 13 2020 20:23 utc | 110

Posted by: William H Warrick MD | Mar 13 2020 17:45 utc | 64

She is the absolute best, isn't she? The fact that she's not allowed to receive positive - or any for that matter - coverage in the media only solidifies that belief for me. I'll never forgive the DNC and the media for the way they've treated Tulsi during this election cycle, and I can't wait to be part of the movement that gets to deliver them to their makers once we've rightly assumed power.

Posted by: information_agent | Mar 13 2020 20:29 utc | 111

Once again, why politicize this?

Why feed the flames or bring up whose fault this belongs to?

In China or America? Who fucking cares?

...

China has taken a hit. Is hunkered down.

America is shutting down currently. And will take an enormous hit.

It does not smack remotely of nefarious, covert release. Not with the blowback.

One minute, those conspiracy minded say the economy is rigged to keep humming the way it has been going. Next, they say this is all controlled demolition (of the economy)...but for what reason?

You guys are fucking stupid and wasting everyone's time stoking these flames.

And, yes, b quoting the NYT when it has blamed the U.S. for its lack of response when just three or four days before the NYT was evidently towing the country-line of: "It's all China's fault!"

So which is it, NYT? China's fault? America's fault? Will this hurt Trump? Will this help China? Will these diminish the yen? Has my mom had sex with Elvis?

Posted by: Nemesiscalling | Mar 13 2020 20:30 utc | 112

Peter AU1 @110

Very true, but do not assume that the lack of a vaccine would hold the CIA back from deploying a weapon that they grabbed from a military lab.

Posted by: William Gruff | Mar 13 2020 20:33 utc | 113

Posted by: William Gruff | Mar 13 2020 20:10 utc | 105

I very doubt this can be done without at least some interventon by the military, I mean, by using their labs, like the infamous Fort Detrick. The CIA has not such labs, thus part of the military is compromised always. The CIA may be involved in the spreading.

Posted by: H.Schmatz | Mar 13 2020 20:36 utc | 114

charlie chan wonders why entire media world fear mongering.

The CDC test kits error 49% to positive.

And charlie chan not hear of one case of flu death. Did Corona Virus cure the flu?

US send 20,000 soldiers to Europe for killing practice (Defender Europe) while locking down US. Are they immune? How?

Posted by: charliechan | Mar 13 2020 20:36 utc | 115

Nemesiscalling @112 <- Post sounds like it is written by someone who knows this bioweapon attack is an own goal and is experiencing posterior pain over it.

Posted by: William Gruff | Mar 13 2020 20:37 utc | 116

Nemesiscalling | Mar 13 2020 20:30 utc | 112 It does not smack remotely of nefarious, covert release. Not with the blowback.

Dude, Just because fools do a foolish thing and make a bioweapon that, as we know from the magician's apprentice and the Golem et sec, is liable and did go wrong - their foolish gadget, a "bug" goes wrong ("blowback") does not mean that they're not fools. Microbiodude @ saker (see that) and that they did not do this, not does it mean that they do understand what they have done.

I screwed Elvis at Woodstock in the mud.

The blowback from the gadgets, the bombs, hair-lipped everybody, would they care?

Posted by: Walter | Mar 13 2020 20:39 utc | 117

I do not believe this pandemic is a consequence of a US bioweapon attack on China, seeing how this pandemic is behaving in every single country, if the virus was circulating in USA some weeks before than in China, as the saker's OldMicrobiologist suggest, it would have devastated the health care system in few weeks, and if those hundred US soldiers that supposedly were spreading the disease in Wuhan would be spreading the infection in the USA, and the USA is being hit hard fully 3 months after hitting hard China.

This is not only crazy, but also stupid and suicidal for any carreerist in the DoD or CIA, if we had some Jack D. Ripper in the Army from 1945 we will not be here chating about Corona

Too many conspiracies at the same time

Posted by: DFC | Mar 13 2020 20:43 utc | 118

H.Schmatz | Mar 13 2020 20:36 utc | 114 Microbio @ saker says CIA does have labs, and they're crazy.

Posted by: Walter | Mar 13 2020 20:45 utc | 119

@ Per/Norway | Mar 13 2020 18:32 utc | 80
Hei from Asker! No gaming here. Our office building of 500 people was evacuated, and we are told to stay at home until the 23rd. With rural surroundings it isn't the end of the world. I still find it hard to judge the severity of it all. As someone said, the fact that so called 'leaders' also are said to contract the virus is an indication it may be what it seems.

Posted by: Norwegian | Mar 13 2020 20:47 utc | 120

DFC
If the virus has been circulating for some time in the US, but hospitals are not swamped with pneumonia cases, there is a good chance vaccine has already been distributed. Either that or the bug was engineered to target certain genetics.

Posted by: Peter AU1 | Mar 13 2020 21:01 utc | 121

What if the United States was only the military headquarters of the actual empire? What if the true heart of the empire was elsewhere; everywhere and nowhere at once because it knows no national boundaries? What if the agents of empire had backed themselves into a corner by angering the entire planet through a combination of war and sanctions while spending trillions upon trillions in money they didn't have all in anticipation of waging a third and (according to their plans) final world war to implement once and for all their oft spoken New World Order?

To blindly assume the United States is responsible for this attack is to ignore the elephant in the room, and that elephant is the menace we're all so familiar with here. They print the money. They control all western governments. Their grip on mass media would make the Wizard of Oz blush, and yet the debate seems to be between whether this is natural or whether it was the US or China who accidentally (or not) released it on the world.

I think it makes a lot more sense to assume it's a group that considers themselves to be above the rest of humanity. A group who would like to destabilize the entire planet in an opening salvo before unleashing whatever successive forms of warfare they have in mind until such time as all governments have collapsed, all nations have been defeated, and they alone get to assume the mantle of the world's only remaining superpower.

Just saying. This seems like something they would do. 9/11 part II: This time it's going viral

Posted by: information_agent | Mar 13 2020 21:06 utc | 122

Posted by: Peter AU1 | Mar 13 2020 21:01 utc | 121

I think now you have the answer to that hypotesis right now in US, and you will see more clearly in the coming weeks, when the deaths skyrocketed in the USA

Posted by: DFC | Mar 13 2020 21:08 utc | 123

I do not buy the theory of a US bioweapon attack on China, as I said before

The reasons for the 5 strains I think is globalization, and USA is at the center of it and it is the country that receive more visits from the rest of the world.

What I could believe is an accidental release of a chimeric virus, (probably made to find vaccines) in China, that was repeatedily researched for example in the following study:

Doctor Zhengli-Li Shi, this woman, as top researcher in Wuhan Instute of Virology, wrote with his group of Wuhan in 2015 the following article I have read & study because I think it is extremely interesting for all what they said:

https://www.nature.com/articles/nm.3985

I invite the commentariat to read carefully the full length article, and I extract some paragraphs I consider interesting, for example they say:

“Therefore, to examine the emergence potential (that is, the potential to infect humans) of circulating bat CoVs, we built a chimeric virus encoding a novel, zoonotic CoV spike protein—from the RsSHC014-CoV sequence that was isolated from Chinese horseshoe bats1—in the context of the SARS-CoV mouse-adapted backbone. The hybrid virus allowed us to evaluate the ability of the novel spike protein to cause disease independently of other necessary adaptive mutations in its natural backbone. Using this approach, we characterized CoV infection mediated by the SHC014 spike protein in primary human airway cells and in vivo, and tested the efficacy of available immune therapeutics against SHC014-CoV”

So they create a “chimeric” SARS-CoV virus that can cause disease (in humans)

They continue:

“we synthesized the SHC014 spike in the context of the replication-competent, mouse-adapted SARS-CoV backbone (we hereafter refer to the chimeric CoV as SHC014-MA15) to maximize the opportunity for pathogenesis and vaccine studies in mice (Supplementary Fig. 2a). Despite predictions from both structure-based modeling and pseudotyping experiments, SHC014-MA15 was viable and replicated to high titers in Vero cells”

So they “maximize the opportunity for pathogenesis” and “replicate to high titers”. Very interesting…

And then they continue saying:

“To test the ability of the SHC014 spike to mediate infection of the human airway, we examined the sensitivity of the human epithelial airway cell line Calu-3 2B4 (ref. 9) to infection and found robust SHC014-MA15 replication, comparable to that of SARS-CoV Urbani (Fig. 1c). To extend these findings, primary human airway epithelial (HAE) cultures were infected and showed robust replication of both viruses”

So in the last paragraph they have found that the new chimeric virus they have created (they called it SHC014-MA15) “show robust replication” in human cells. A great success I guess…

But they continue with the research and say:

“We next analyzed infection in more susceptible, aged (12-month-old) animals. SARS-MA15–infected animals rapidly lost weight and succumbed to infection”

So they test the new chimeric virus (they call it SARS-MA15 and also SCH014-MA15) in mice and they saw a high pathogenicity in the lungs of the animals, more acute in older ones.

Then they continue with the trials of the SHC014-MA15 chimeric virus they created:

“Similarly, antibodies 230.15 and 227.14, which were derived from memory B cells of SARS-CoV–infected patients13, also failed to block SHC014-MA15 replication (Fig. 2b,c). For all three antibodies, differences between the SARS and SHC014 spike amino acid sequences corresponded to direct or adjacent residue changes found in SARS-CoV escape mutants (fm6 N479R; 230.15 L443V; 227.14 K390Q/E), which probably explains the absence of the antibodies’ neutralizing activity against SHC014. Finally, monoclonal antibody 109.8 was able to achieve 50% neutralization of SHC014-MA15, but only at high concentrations (10 μg/ml) (Fig. 2d). Together, the results demonstrate that broadly neutralizing antibodies against SARS-CoV may only have marginal efficacy against emergent SARS-like CoV strains such as SHC014.”

So it seems that the new chimeric virus they created is quite resilient to the antibodies normally used to treat SARS. So there are not good news.

Still more about the risks of their chimeric virus:

“the creation of chimeric viruses such as SHC014-MA15 was not expected to increase pathogenicity. Although SHC014-MA15 is attenuated relative to its parental mouse-adapted SARS-CoV, similar studies examining the pathogenicity of CoVs with the wild-type Urbani spike within the MA15 backbone showed no weight loss in mice and reduced viral replication23. Thus, relative to the Urbani spike–MA15 CoV, SHC014-MA15 shows a gain in pathogenesis (Fig. 1). On the basis of these findings, scientific review panels may deem similar studies building chimeric viruses based on circulating strains too risky to pursue, as increased pathogenicity in mammalian models cannot be excluded”

So they recognize they have created a very dangerous chimeric virus with a high pathogenesis, nobody expect to be more pathogenic (paradigm change), and easily transmitted in human cells and hard to fight by antibodies, and they said at the end “building chimeric viruses based on circulating strains too risky to pursue, as increased pathegenicity in mammalian models cannot be excluded”
Do you feel a cold sweat?

At the end of the article they said:

“Coupled with restrictions on mouse-adapted strains and the development of monoclonal antibodies using escape mutants, research into CoV emergence and therapeutic efficacy may be severely limited moving forward. Together, these data and restrictions represent a crossroads of GOF research concerns; the potential to prepare for and mitigate future outbreaks must be weighed against the risk of creating more dangerous pathogens. In developing policies moving forward, it is important to consider the value of the data generated by these studies and whether these types of chimeric virus studies warrant further investigation versus the inherent risks involved ”

So I have some questions to ask:

a) What are the probabilities that a strange new virus, never seen before, very easily transmitted and very pathogenic, started exactly some thousands meters from the research lab where these people were creating dangeorus SARS chimeric viruses one day and the following?

b) What are the probabilities that a new “wild” virus be so similar to this chimeric virus created in 2015 for this study? Could it be a self-fulfilling prophecy?

Posted by: DFC | Mar 13 2020 21:12 utc | 124

DFC
China is also wondering when coronavirus first appeared in the US. It does appear to have been running for some time undetected in the US. Long enough from what I can make of it that hospitals should now be swamped.

Posted by: Peter AU1 | Mar 13 2020 21:12 utc | 125

If it were a consequence of a US bioweapon attack on China, it would be particularly stupid. But that's what I expect of the US.

Posted by: Laguerre | Mar 13 2020 21:14 utc | 126

Read the very long set of comments by OldMicrobiologist at The Saker's, and it jibes with material he's written before, all of which I have no grounds to doubt. I agree with Gruff @105 regarding China's response and add that its "Good Neighbor" outreach to other affected nations is a part of that response--Italy it should be noted was very positive about BRI. Also, I expect a very important quid pro quo from the Koreas to the vast detriment of the Empire. The blowback's going to be massively destructive to the Empire's economy.

Very often since Trump's election, China has rightly accused the Outlaw US Empire of "Arrogance" of the worst sort--racist and otherwise. Whatever China decides to do will be in concert with Russia. Backing out of the recently agreed Trade Deal is almost a certainty. Would China consider a total embargo on trade or something very specific and symbolic like all pharmaceuticals and related goods?

Meanwhile, the head of Public Citizen, Robert Weissman, has called on Trump to resign using language Circe would applaud:

"President Donald Trump is a clear and present danger to the nation's public health, and he should resign immediately.

"In a time when protecting the nation's public health demands clear, truthful, and compassionate leadership, Trump has offered exactly the opposite.

"He has dissembled about the seriousness of the coronavirus epidemic, either because he refuses to accept the truth or fears the impact on his political fortunes, or both.

"He has refused to make science-based recommendations (e.g., older people should avoid cruise ships and plane travel) or to declare a public health emergency out of fear about the impact on the stock market.

"He has misstated his administration's own policies.

"He has presided over an administration that has inexplicably failed to deliver vitally needed coronavirus tests to healthcare providers around the country and then repeatedly lied to or misled the American public about remedying the problem. Instead of taking responsibility for the problem and fixing it, Trump has bizarrely blamed it on his predecessor, Barack Obama.

"He has attacked his political rivals rather than seek to bring the country together.

"These failings have nothing to do with political ideology or legitimate areas of policy disagreement. They are intolerable failures of leadership in a time of national crisis that have endangered the lives of all Americans. Trump should step down immediately."

The only thing missing is inclusion of Mike Pence for doing the same. Of course, Trump won't resign, but it will be of great interest to see if Weissman's demand is reported on by BigLie Media.

And lastly, Sanders made a major address @3 hours ago that can be viewed and read via transcript here. Just a few of his well stated words:

"And let’s be clear. Lack of healthcare and affordable medicine does not only threaten the healthcare and well-being of the uninsured. It threatens everyone who comes in contact with them.

"In fact, what this crisis is beginning to teach us is that we are only as safe as the least insured person in America."

The only two words he doesn't explicitly say about this crisis and why it's so is Moral Failure.

Posted by: karlof1 | Mar 13 2020 21:17 utc | 127

Posted by: karlof1 | Mar 13 2020 21:17 utc | 127

Fat chance of getting anything out of Trump.

Posted by: Laguerre | Mar 13 2020 21:24 utc | 128

DFC posted 123 then his 124 was posted only 4 minutes later, which I find improbable unless it was already prepared.

Posted by: karlof1 | Mar 13 2020 21:27 utc | 129

So ...population of 327 million
Between 160 million - 214 million (50-65%) infected over the course of the epidemic
Between 2.4 million to 21 million (1%- 6%) require hospitalization
Between 200,000 to 1.7 million (up to 0,5%) can die

Then again look at cases per million citizens, China so far: 56.1 = 0,005%
Please note the China has 1386 million people, four times the US.

Now it's unclear if China contains this but to go from 0,005 to 65% after three months of raging might be a much.
Now take South Korea 155.6/million or Spain 111.9/million are now on 0.02 % and 0,01% (worse that way than China).

China and South Korea growth of registered cases is near standing still. But, that came by a price.
Massive mobilization of society to act and massive testing might have been a key. It's unclear this is doable in the West.

Note Italy, Norway and Denmark are doing very bad right now in relation to population amount and density. The worst of the world. But move fast and it will remain in single digits.

Posted by: John Dowser | Mar 13 2020 21:28 utc | 130

Laguerre @128--

Well, he's rather corpulent, so he ought to burn well and emit some quality BTUs.

Posted by: karlof1 | Mar 13 2020 21:30 utc | 131

Posted by: karlof1 | Mar 13 2020 21:27 utc | 129

Yes in many cases I wrote my comments in word before posting, if there are elaborated; my english is not very good and I use word to (try) to correct some mistakes, and sometimes I re-used some content of other comments (as was some parts in this cases)

Posted by: DFC | Mar 13 2020 21:40 utc | 132

@Rucio 5

Moon of Alabama regurgitating the New York Times and National Public Radio. Sad!

You are an idiot.

It is true that the MSM serves up a lot of bullshit but people with a functioning brain are usually able to differentiate between the garbage and the stories that have validity. Only an utter fool with no reasoning abilities would categorically dismiss every single article that appears in a mainstream publication. People like you that need a big daddy authority figure to tell them what they are allowed to read and how to think are truly messed up. Sad indeed...

Posted by: Daniel | Mar 13 2020 21:48 utc | 133

As far as the west goes, If this had been delt with properly only two months ago —— —
‘This would now be academic instead of pandemic ‘
It’s time to point the finger of blame !
Take a look at the USA war crime profile!

Posted by: Mark2 | Mar 13 2020 21:59 utc | 134

>to correct some mistakes

I very much appreciate that folks who do not speak English as their first language, come here to post. Grammar and spelling mistakes don't matter; please keep writing comments.

Posted by: Trailer Trash | Mar 13 2020 22:05 utc | 135

Camus’s "The Plague"...for soporific relief.

Posted by: Walter | Mar 13 2020 22:07 utc | 136

@ Posted by: John Dowser | Mar 13 2020 21:28 utc | 130

The key to China's success lied in the fact that it stopped the COVID-19 before it reached Shanghai-Beijing to the north and Shenzhen to the south. Those are the two great population and economic centers that vertebrate the chinese economy.

Ultimately, the sacrifice of 60 million people saved 1 billion.

That's why South Korea must protect Seul and Japan must protect Tokyo. Everything is fair game for those two countries if it results in the protection of those two cities. If those two cities are hit, the game is over for both countries.

Italy didn't have the same luck, because the epidemic started precisely at its most rich region (the north-northeast). It will suffer the most. And I'm assuming here Tokyo isn't already "gone": Japan has turned back to being Japan and simply stopped releasing its number of infected and dead. However, we know the Diet passed an emergency bill and that the imperical family has moved out the imperial palace in central Tokyo.

Posted by: vk | Mar 13 2020 22:09 utc | 137

@Joanne Leon 15

The explosion of hate and blame and fear flying around online with regard to this pandemic is more than alarming and ultimately useless and damaging. In a way it scares me more than the flu itself at the moment because of the implications of how it will hinder our ability to cooperate and deal with this.

That’s a good point. Western society with its twisted guiding philosophy of radical individualism and competition combined with a supremacist “that could never happen here” attitude quickly falls into panicked chaos when reality kicks in and reveals the society’s underlying vulnerabilities. Countries with weak social safety nets and an ideological opposition to social responsibility are extremely vulnerable to systemic breakdown when their societies are under unexpected stress.

This virus is revealing just how ineffective the neoliberal social Darwinist “every man for himself” ethos is and how deeply in denial and out of touch with reality these societies are. Additionally, the house of cards that makes up the global economy has been in crisis mode since 2008, when it was bailed out by massive money printing in the US and EU and China pumping billions of dollars into the economy to keep it afloat, simply can’t handle any additional stressors without going into breakdown mode.

In this kind of situation where clear headed cooperation and mutual effort are required the opposite happens and people go into panic and finger pointing mode looking for some external enemy to blame. Just imagine what will happen if global warming turns out to be as serious as many are predicting.

Posted by: Daniel | Mar 13 2020 22:16 utc | 138

The Wuhan Institute of Virology was working actively in this kind of chimeric virus and COV in bats from longtime:

In this study they make again a novel chimeric viruses and particles in 2018:

https://link.springer.com/content/pdf/10.1007%2Fs12250-018-0064-8.pdf

Study about coronaviruses in bats in Yuhan, where ther are big amounts of wild bats, many more than in Wuhan:

https://link.springer.com/content/pdf/10.1007%2Fs12250-018-0017-2.pdf

Study of coronavirus infections in humans but in Yunnan where you could expect this to happens, but always very low infection rate:

https://link.springer.com/content/pdf/10.1007%2Fs12250-018-0012-7.pdf

But Guangdong Province is the primary region in China in which wildlife is being consumed. Since the supply of wildlife for consumption in Guangdong mainly comes from Yunnan and Guangxi Provinces; and then why the pandemic start in a place (Wuhan) with low wild animals and a wild life market very small compare with those in Guandong province they sell many more bats and wild animals than in Wuhan. Also the population of wild bats in Wuhan is very low compared to Yunnan or Guangxi, so, why in Wuhan with so virulence?

Strange

Posted by: DFC | Mar 13 2020 22:17 utc | 139

This is very important:

Chinese studies link quarantines with coronavirus mutations that may make it more 'insidious'

The important thing here is that the headline above is clickbait. At the end of the article, we read the truth:

Paul Young, head of the University of Queensland's School of Chemistry and Molecular Biosciences, said the coronavirus would acquire new, random mutations as it spread.

"This is normal for a virus that contains an RNA genome [like Sars-CoV-2]. They naturally acquire mutations as they replicate," he said.

"Most of these mutations, being random, have nothing to do with adaptation to the host and are simply a reflection of the high error rate in copying the viral genome."

The European Centre for Disease Prevention and Control said comparing the data from patients in Italy to that of other places would provide a better understanding of the virus.

"Genomic information can support the identification of targets for treatment and vaccine development too, as well as the development of rapid diagnostic tests," a spokesperson for the centre said. "In addition, by following the genomic changes over time, researchers can get the information on what happened to the virus in the past and foresee what can happen to it in the future."

But others noted that the studies on the virus' mutation were far from conclusive.

"The hospital observation in Wuhan, though valuable, must be treated with caution because it involved less than 100 patients," said a doctor at a public hospital in Beijing treating virus patients who requested anonymity.

"Whether quarantine measures could have had such a big ― and almost instant ― impact on the evolution of the virus remains unclear."

So, I'll repeat this basic, universal principle of the theory of evolution: RNA/DNA mutations always - always - happen randomly. There's no teleology in evolution and natural selection.

Posted by: vk | Mar 13 2020 22:17 utc | 140

Re question: "Why don't we have more dead people yet?"

1.) It is a good question, but,

2.) We don't really know that since we have not been testing and everything is "flu" , and

3.) Exponential growth can take a while to go "exponential", it depends on the exponent, and that depends too.

4.) But as time goes on, esp. once mass testing is being done, the question becomes better.

Posted by: Bemildred | Mar 13 2020 22:35 utc | 141

"Interferon Alpha 2B (IFNrec)"

Posted by: Biloximarxkelly | Mar 13 2020 22:46 utc | 142

When Trump wanted to randomly show a strong hand, he authorized an assassination. When some strong hand might actually help... “has anyone ever even met anyone who died of the flu?”

Posted by: Fly | Mar 13 2020 22:49 utc | 143

Corona statistics vary a lot, within China there is a large difference between Wuhan statistics and the rest of China. The most complete coverage - though the disease is still developing - is in South Korea and the CFR is low there and expected to stay low. There is another number however is Chinese data which is treated as a general estimate while it could be based mostly on Wuhan data: a distribution of 80% mild/15% severe and 5% critical. Only I don't see that reflected in the country statistics at virusncov.com. There South Korea at the moment has sth like 1.2% serious or critical. A lot of people might still become seriously ill so I can't tell for sure but the serious/critical category overall seems to be small. Italy is an exception but they may be in the 'early Wuhan' case where they have a high threshold for detecting illness. This number is important though because while the overall death rate in controlled situations is not excessive we base our policy on the high risk critical stage to justify extreme measures for flattening the curve. Anyone who has a recent estimate of the ratio mild/severe/critical?

Posted by: Tuyzentfloot | Mar 13 2020 23:05 utc | 144

Rather ominous article from W. Webb in Mintpress:

https://www.mintpressnews.com/us-intelligence-unsettling-role-classified-9-11-like-coronavirus-response/265687/

This quote is particularly trouble some:

“ While the plans of the federal government remain classified, recent reports have revealed that the military and intelligence communities — now working with the NSC to develop the government’s coronavirus response — have anticipated a massive explosion in cases for weeks. U.S. military intelligence came to the conclusion over a month ago that coronavirus cases would reach “pandemic proportions” domestically by the end of March. That military intelligence agency, known as the National Center for Medical Intelligence (NCMI), coordinates closely with the National Security Agency (NSA) to conduct “medical SIGINT [signals intelligence].”

Posted by: Alpi | Mar 13 2020 23:09 utc | 145

@81 vk
"Private healthcare systems can only be overrun if they want to....." that is exactly right.

In the US, the first reaction in crisis for the govt is to write a big check to the favored contractor in any given industry. This habit is going to have to change fast, I don't know if it can.

@various people, wondering whether it is a biological weapon, or more realistically, the possibility that it is a research project that escaped from a lab (at an institution that was, perhaps, constructed with the purpose of studying biological weapons)... While this is a fascinating question, I would say there are more immediate concerns, no?

Locally: NY State has still apparently not completed tests for suspected people who don't have serious symptoms. NY City number confirmed cases up 50% today (to about 150). I believe that figure reflects the events of 4-6 days ago. The current wave of panic shopping becomes another transmission point....

Posted by: ptb | Mar 13 2020 23:17 utc | 146

Alpi @145

Also worrisome: US Govt now has the 'National Emergency' that many have long dreaded.

!!

Posted by: Jackrabbit | Mar 13 2020 23:20 utc | 147

@22 Norwegian

Thank you for your comment to me:)

"My wife and I are locked down for 2 weeks. I am not sure what to believe, but it does not smell very good."

Is the State making you be in lock down? In the U.S., where I live, there are three churches within a few blocks of me. People still go to church, the restaurant/bars, and grocery stores are their normal fairly busy selves. But on the Internet and TV it's like a different world. Maybe in the bigger cities it's more noticeably panicky, but not here. Oh and they adore Trump where I live. It's pretty gross. But it's always pretty gross when I'm around people who love a U.S. President;)

Posted by: SharonM | Mar 13 2020 23:22 utc | 148

@ 142

Interferon......Leave it to the Cubans to finally save us from this disease. That is what helped the Chinese to contain the spread and not a word is being said about it. Shameful.

On another note, Pete Koenig brings up a very serious charge of US capitalizing on this fear and panic of “pandemia” to roll out their mass surveillance in form of RFID injected vaccines. This combine with the article I mentioned above, military and intelligence response to this crisis, makes for fiction only seen in a Hollywood movie.

https://www.globalresearch.ca/coronavirus-causes-effects-real-danger-agenda-id2020/5706153

Posted by: Alpi57 | Mar 13 2020 23:22 utc | 149

Bemildred @141:

We don't really know that since we have not been testing and everything is "flu"

In January there were accusations that China was covering up cases by (deliberately) mislabeling cause of death as "pneumonia".

Seems likely that such "mislabeling" has been happening in the West.

!!

Posted by: Jackrabbit | Mar 13 2020 23:25 utc | 150

Tuyzentfloot @144: Anyone who has a recent estimate of the ratio mild/severe/critical?

It varies by age and other factors.

!!

Posted by: Jackrabbit | Mar 13 2020 23:26 utc | 151

Hi B,
one of the big issues with COVID-19 is the appearance of a novel furin proteinase site in the viral spike protein. It doesn't appear in any of the related bat viruses and is new in evolution. So this is a small insert of four amino acids PRRA, to make the site PRRAR and is a perfect target for a host enzyme termed proprotein convertase or furin. The question is where did the insert come from? Could be from a wild bat virus we haven't seen yet or did someone insert the sequence. Adding a furin site enhances pathogenicity -- the ability of the virus to make you sick. Basically the spike protein binds to a cell and the furin proteinase cleaves it allowing the virus to fuse with the and infect it.
So if someone inserted the furin site we might be able to catch the reprobate as most investigators buy their custom DNA from companies like IDT. All we have to do is search their databases with this sequence agactaattctcctcggcgggcacgtagtgtagctagtcaat and bingo. This strategy will fail if they made the oligos in house with a synthesizer--- but these guys are so stupid they probably got them made by a commercial company. So we might be able to at least see it someone created a gain of function (GOF) virus with this site, then ask them some pretty serious questions.-cj

Posted by: cj | Mar 13 2020 23:26 utc | 152

@148 SharonM

You have been decrying the chicken littles for a week or so now.

I don't blame you. I am on the fence, but will probably only be able to see the forests for the trees once it blows over and we see exactly what big gov was allowed to get away with as they stoked the fires of fear.

In the PAC NW, schools are closing through April and Catholic churches are not holding mass during this Lenten season. Stores are emptying and having record sales days.

Hard to get a read on how bad, but I hope you are right and it's a nothing-burger.

One thing is already for certain: the government shutting things down now means they will be able to control the narrative in the history books.

"We saved a million lives because of the clamp-down." Dangerous precedents abound.

If the virus don't getcha, the government will." Interesting times for the foreseeable future.

Posted by: Nemesiscalling | Mar 13 2020 23:45 utc | 153

Walter @136--

Yes, The Plague as allegorical cover since he couldn't be honest about his writing intent when he began it in 1941. Many writers have resorted to that tactic, Melville in Moby Dick is a classic example.

Another example of previous R-Party lunacy that's contributed greatly to today's crisis. And I'll end my day here with yet another example of Moral Failure.

Posted by: karlof1 | Mar 13 2020 23:48 utc | 154

information_agent @ 122

You are correct. The real danger of the Covid-19 is not in its virulence or its transmissibility. The Covid-19 virus has one main purpose – to justify locking down societies and limiting movement. The release of the virus is a deliberate move by the global elites to generate fear so that people will clamor to be jailed in their immediate districts. Hence the media fear-mongering, the media being controlled by the global elite. Ans, people are generlaly fearful and stupid so will accept their loss of freedom meekly. This event marks the beginning of a world wide feudal order.

Posted by: JasonT | Mar 13 2020 23:53 utc | 155

@153

“...... One thing is already for certain: the government shutting things down now means they will be able to control the narrative in the history books.”

It is much more sinister than that.

Posted by: Alpi | Mar 13 2020 23:54 utc | 156

NYT and NPR? I sit and watch the West slowly ramp up getting more and more serious. Was China really any different? What was the expectation? Shut the planet down overnight for the next three months? Everyone go and hide in their inner rooms tomorrow?

Sequence the DNA of the virus in a few days and create the perfect test a week later? Crank out a vaccine in a month? Inject every person in the West in a week or two. It is all overreach by the armchair quarterbacks.

Posted by: dltravers | Mar 13 2020 23:56 utc | 157

@153 Nemesiscalling

"You have been decrying the chicken littles for a week or so now.
I don't blame you. I am on the fence"

Of course, I haven't changed my mind, Nemesiscalling. The panic is the danger. It will mean the cessation of many rights for people around the world, and definitely here in the U.S. From mandatory vaccination to martial law. It's the flu, and like any flu it still feels awful and kills people. So I wouldn't ever call the flu a "nothing-burger". But people calling for government action in the way we're witnessing it is absurd and dangerous;)

Posted by: SharonM | Mar 14 2020 0:07 utc | 158

I found this interesting

“The average age of the deceased was 81, the average number of pathologies observed in this population was 3.4 (median 3, standard deviation 2.1). The most common comorbidities for these patients included hypertension, diabetes, etc. [2] Doctors have emphasized in media interviews that while the deceased tested positive for the coronavirus before or after death; it cannot always be ascertained they died because of it.

https://thesaker.is/letter-from-locked-down-lombardy/

Also, from the same article “Italy’s healthcare systems are managed regionally; in Lombardy by the (recently ousted)right wing Lega government led by Attilio Fontana. Lombardy has 16% of Italy’s population......While the Lega was busy creating panic and chaos in Lombardy, Salvini was running around giving international interviews to the likes of El Pais to complain about the Italian government.”

Hmmm. A right wing coup in the making in the spirit of Operation Gladio?

And this “In a move certain to cause consternation among American officials and leaders of the European Union, Italy appears poised to help China extend its vast global infrastructure push deeper into Western Europe, part of Beijing’s sweeping plan to advance its economic interests and influence around the world.
A first step toward Italy’s cooperation on the Chinese initiative, One Belt, One Road, would be the signing of a memorandum of understanding when President Xi Jinping of China visits Rome this month (march 22)
, Michele Geraci, Italy’s under secretary in the economic development ministry, said in an interview on Wednesday.
“We are not yet as of today 100 percent sure,” said Mr. Geraci, one of the lead negotiators on the agreement. “But I think there is a likely, good probability.”
If Italy takes such a step toward encouraging Chinese investment, it will be the first member of the Group of 7, the world’s richest economies, to actively participate in Beijing’s effort to build cargo hubs around the world to fuel its own economic growth”

https://www.nytimes.com/2019/03/06/world/europe/italy-ports-china.html

And we have that outbreak in Iran. China is Irans largest trading partner. So China, Iran and Italy all hardest hit by the virus should make an interesting story yet nobody seems able to connect the dots


Posted by: Pft | Mar 14 2020 0:07 utc | 159

dltravers

Bed space and ventilators, testing and tracking to understand the spread - from what I make of it, US has done nothing in the way of preparation. Some autopsies have shown pneumonia due to coronavirus. Why weren't they checked for coronavirus before they died. how many people have died of 'pneumonia' in the US and haven't been checked for coronavirus.
My daughter is a nurse at a private hospital here in Australia. They recently had a hospital meeting on coronavirus. They do believe US will see large death rates due to lack of preparation. Quarantine only needs putting in place at the right time prevent hospitals being swamped, but many other preparations can be done before that stage.

"It is all overreach by the armchair quarterbacks."
I'm not sure that hospitals in oz qualify as armchair quarterbacks when it comes to coronavirus.

Posted by: Peter AU1 | Mar 14 2020 0:19 utc | 160

@John Dowser #130
Zero credibility numbers.
Of the 3500 people trapped on the first cruise ship - less than 20% got it. You can't get a better infection setup than having people breathing the same air with infected people, with another 1000 service people sharing a huge dorm with no walls and bringing food to everyone.
So 20% is very likely the worst case in 1 year.
1% of that is still bad, but again, a function of timing. Are they evenly spread out over, say, 6 week time frames? Then its bad but doable.
If they're getting it all in the same quarter, then it is really bad.
But that's why states are ordering lockdowns: pro and college sports cancelled, music/entertainment cancelled, conferences etc.

Posted by: c1ue | Mar 14 2020 0:21 utc | 161

RNA/DNA mutations always - always - happen randomly. There's no teleology in evolution and natural selection.

Bingo!
We have a winner

Posted by: Duncan Idaho | Mar 14 2020 0:23 utc | 162

@conspiracy theorists: try and use some critical thinking.
We have had a number of novel viruses break out in the recent past: Ebola, swine flu, SARS, MERS among the major ones.
Why is it so surprising that we finally got one that happens to be significantly transmissible (unlike SARS), deadly but not too deadly (unlike Ebola) and situated in a region where people travel to/from a lot (unlike MERS)?

Secondly, the genetic sequencing is quite advanced and in the hands of a lot of different people. There is a 96% match between Wuhan bat coronavirus and nCOV; 99% match between pangolin coronavirus and nCOV. Secondly, viruses in general mutate because they are mostly really shitty in error correcting when replicating - so we know they will change over time.

The reality is that governments and scientists simply do not have the capabilities to design a virus to this specification - at least, not yet.

Posted by: c1ue | Mar 14 2020 0:26 utc | 163

@Pft #159
Actually, the US is China's largest trading partner.
Iran's entire foreign trade is a fraction of what China exports to the US.
So yes, connect the dots. Why is Italy worse than the US - when the US trades far more? Maybe because Italy is really old, has very poor hospital support for a EU country and has been under austerity for a long, long time?

Posted by: c1ue | Mar 14 2020 0:29 utc | 164

@ Posted by: vk | Mar 13 2020 22:17 utc | 140 "repeat this basic, universal principle of the theory of evolution: RNA/DNA mutations always - always - happen randomly. There's no teleology in evolution and natural selection." Yes, quite so. However there is teleology elsewhere... The flow of electrons in an arc is random. Man makes arcs. Jacob dug a well. When Wally brews coffee he uses random electrons to heat the beverage, by design.

Posted by: Walter | Mar 14 2020 0:29 utc | 165

Mutations may occur randomly, but survival of the fittest dtermines which mutations survive.

Posted by: lysias | Mar 14 2020 0:35 utc | 166

On a related news, Bill Gates resigns from his post at Microsoft to ¨dedicate more time to global health¨. Very suspicious.

Posted by: Alpi | Mar 14 2020 0:40 utc | 167

crue @163

Ebola, swine flu, SARS, MERS were all previous generation bioweapons for the purpose of priming people for further incidents. Ebola, swine flu, SARS, MERS provided invaluable data on how such bioweapons can be best used to generate the appropriate level of fear in people. It is not necessary for scientists to "have the capabilities to design a virus to this specification". They do have the capabilities to design viruses that build on the previous ones, though, and Covid-19 is simply the next generation bioweapon to be used to ramp up the fear. The issue is NOT the specifications of the Covid-19 virus. The issue is that the global elite have taken the next step in their program for world dominance. It is the generation of Fear that is important to the program, not the specifics of the viruses lethality and transmissibility. And Covid-19 is the one that will be used to implement the lock-down phase in the establishment of the new feudal order.

Simply put - the purpose is the generation of Fear so that people accept containment. The specifics are irrelevant and merely a side show to distract people from the purpose.

Posted by: JasonT | Mar 14 2020 0:49 utc | 168

Daniel @ 133; Your chastisement expressed was richly deserved and had me LMAO, thanks.

@ 138; Another great, but, more serious indictment aimed at our dysfunctional society, was awesome, thanks!

Posted by: ben | Mar 14 2020 0:52 utc | 169

Hey B!
I hope we don't have to wait long for your piece about this.
I've run the gamut of emotions over this from what I've read and heard from various sources, from this is a "hoax" or just the flu no worries to our gov is incompetent this virus is real and many will die.
It seems insane that there are only 40 tests available in our state and they won't test unless you are seriously ill requiring hospitalization!!
The gov is also running a seeming test don't tell program
How the hell can they hide this illness for long?
People are already asking questions! Which is a GOOD thing.

Posted by: Annie | Mar 14 2020 0:54 utc | 170

Alpi 167

https://www.uq.edu.au/news/article/2020/02/significant-step’-covid-19-vaccine-quest
"In just three weeks, the team of researchers has created their first vaccine candidate in the laboratory and will move immediately into further development before formal pre-clinical testing.
The proof-of-concept milestone comes after the project’s announcement on 24 January as part of the Coalition for Epidemic Preparedness Innovations (CEPI) rapid response program."

Coalition for Epidemic Preparedness Innovations
https://cepi.net/about/whoweare/
"CEPI was founded in Davos by the governments of Norway and India, the Bill & Melinda Gates Foundation, the Wellcome Trust, and the World Economic Forum.
CEPI has secured $760 million toward its $1billion funding target, with multi-year funding from Norway, UK, Germany, Japan, Canada, Ethiopia, Australia, the Bill & Melinda Gates Foundation, and Wellcome. CEPI has also received single-year investments from the governments of Belgium. The European Commission provides substantial financial contributions to support relevant projects through its mechanisms."

CEPI wikipedia page
https://en.wikipedia.org/wiki/Co

Posted by: Peter AU1 | Mar 14 2020 1:00 utc | 171

You were born with 2 hands at the ends of your arm so use them and quit complaining the government needs to do this or that. When things get really bad government can only do so much. Far too many Americans, and others around the world, think everything is as simple as snapping your fingers and it's done. For example it's a large involved process to get electricity to our homes yet people act like it magically appears. Instead of appreciating how cheap and available things are thanks to innovation and hard work just lots of whining about how expensive it is. Like gasoline for your car. Oh yeah, it grows on bushes just over the next hill.

As far as the Trump bashing we don't know what they were doing behind the scenes before now. We do know Trump put an early ban on fights from China which people here and the media have swept under the rug. Now they are complaining about Trump trying to close the border and trying to undo his European travel ban. When Trump was doing things all you got was politically motivated complaints and roadblocks from the Democrats. From day one the Democrats should have stood on the podium next to Trump and declared their support but they didn't. Only now weeks later have they decided to support but are still trying to hinder Trumps efforts. If Trump was behind the curve what's the excuse for the Democrats and the Congress

What isn't mentioned by the mainstream media is Trump and his people were being tied up by the Democrats and their impeachment circus. Even after the Senate trial screams for days we should have had more witnesses and relentless bashing by the Democrats and the press the fix was in at the Senate, it wasn't as the whole thing was a joke and they ended it, and Trump was never aquitted. Lawsuits and threats to Trumps staff if they didn't crawl to Nancy and shifty Schiff and pour their heart out.

Posted by: snedly arkus | Mar 14 2020 1:20 utc | 172

What vk wrote is entirely correct but I'll go further: there is no such thing as "survival of the fittest"; the notion is a complete misunderstanding of how life works.

Instead the case is always (whether a human or a virus or any other known life) that one can be as much "the fittest" one likes but it doesn't matter at all because the only things that actually matters is "survival" and "survival" is entirely dominated by what is essentially (at scale, and it's all at scale) a completely random context and essentially plain luck (also known as fate).

The notion of "fittest" (as well as luck and fate) can only ever be defined retroactively by looking backwards in time and judging by later "survival" which when given enough time changes into a merit of some form of procreation or lasting effect/legacy since effectively all life eventually dies (even those regenerating/rejuvenating jellyfish etc.). As such it is an entirely meaningless distinction with zero predictive or explanatory power in addition to being wrong ("the luckiest survive" would be far more correct yet still an essentially useless statement except when used to point out the flaws of the oft-quoted original incorrect trope).

It gets even less meaningful when one considers that procreation of survivors in no way guarantees that the progeny will themselves survive or inherit whatever nuance helped their parent(s) survive.

Much more could be said, but I'll stop boring people :D

Posted by: Sunny Runny Burger | Mar 14 2020 1:28 utc | 173

Sunny Runny Burger | Mar 14 2020 1:28 utc | 173

Yes.

However the question lies elsewhere. Man routinely manipulates random processes, as I wrote. Boil water...the heat transfer is random, but the water gets hot.

Posted by: Walter | Mar 14 2020 1:31 utc | 174

@ Posted by: JasonT | Mar 13 2020 23:53 utc | 155

That may end up being the case for the USA and other westerm democracies, but definitely not for China:

Commentary: Do not let economic globalization fall victim of pandemic

China to fast-track work resumption across industrial chain

And those are just from today. The Chinese media has been touting this narrative (quick recover, fast-track resumption of the economy, keep the targets for the year) since the epidemic started.

Posted by: vk | Mar 14 2020 1:39 utc | 175

@JasonT #168
To a hammer, everything is a nail.

Posted by: c1ue | Mar 14 2020 1:41 utc | 176

@Sunny Runny Burger #173
Or in other words: if its stupid but the organism survives, it isn't stupid.
Or "proof is in the pudding".
etc etc.

Posted by: c1ue | Mar 14 2020 1:43 utc | 177

@171


..........and?

Posted by: Alpi | Mar 14 2020 1:47 utc | 178

With national emergency declared, FEMA's USD 50 billion is unlocked to fight the COVID-19 pandemic. FEMA is one of the few federal institutions which still works and works very well, so I would not be worried about them if I were American.

The problem will be the relief package to be soon passed by both houses. I expect it to be of equal or bigger than FEMA's available fund (i.e. higher than those previously mentioned USD 50 billion). If they just approve said package and simply throw it at the private sector, then this will be a huge long-term problem to the USA, since it will increase inequality even more, enriching private companies and fuelling corruption.

Posted by: vk | Mar 14 2020 1:48 utc | 179

@179 vk

"FEMA is one of the few federal institutions which still works and works very well, so I would not be worried about them if I were American."

lol If you were an American, you'd probably remember Hurricane Katrina, and how FEMA doesn't work very well:D

Posted by: SharonM | Mar 14 2020 2:05 utc | 180

@ 180 SharonM

Made me laugh too. I guess we needed a bit of lighthearted commentary.

Posted by: Alpi | Mar 14 2020 2:09 utc | 181

@ Posted by: SharonM | Mar 14 2020 2:05 utc | 180

Katrina was a special case. Thanks to Naomi Klein's journalistic book, we know the WH directly intervened.

Posted by: vk | Mar 14 2020 2:12 utc | 182

RE: "survival of the fittest"

It is true that it is a tautology (circular logic, you get what you assume). A creature is fit because it reproduces, and it reproduces because it was fit.

It is also true that pretty much all of Mathematics works that way, you assume something and derive what consequences you can from them, by certain rules you also assume.

Yet it is not meaningless or uninformative.

Reproduction is a fact that makes it more likely the creature "worked well". Statistically, it works fine, individually, it means they had a lot of luck too. A lot better than, say, "if you're rich you must be smart", e.g. Trump.

The failure is in the claim that "survival of the fittest" applies to individuals, it doesn't. Statistical measures never do.

Posted by: Bemildred | Mar 14 2020 2:15 utc | 183

@ Alpi

Yes:D

@ vk

A "special case" is pretty hilarious, vk. How about asking Puerto Ricans what they think of FEMA;)

Posted by: SharonM | Mar 14 2020 2:23 utc | 184

#180

The only US federal institutions that work well are the IRS and the military...When they are bullying the 99%.

In the case of the IRS, they get their things done sure but at the huge expense of the people. Just think about the sheer amount of time and money wasted on doing tax filings by salaryman Americans. In much more civilized places like Singapore, the government does all the paperwork, the only thing do you need to do is whether to raise a dispute when you see the final tax bill.

Posted by: JW | Mar 14 2020 2:32 utc | 185

Alpi 178

and what. Information is there on Gates. Make of it what you will. I currently dont have an opinion either way as to the intentions of Gates.

Posted by: Peter AU1 | Mar 14 2020 2:40 utc | 186

This is a transformational moment in history that will allow American politics to socialize and turn away resolutely from the anti-government stupidity represented by Trump and all the anti-New Deal elements among the elite predators that have dominated politically since Reagan. It is a mistake to chose Biden, chief author of the Patriot Act, business-as-usual candidate, corporate lackey, weasel. Bernie is the only rational choice, but the American people are not rational, and do not yet understand the urgency of a radical left turn. Much suffering will be the result and a radical right turn could occur, although disenchantment with the blithering idiocy of Donald Trump has already deprived him of any chance of re-election. The virus is going to take him down before profound political embarrassment. He's a dead man walking.This may be true of Bernie & Biden as well, but I say this without prejudice.

The Chinese clearly knew the character of this virus before it became apparent to the world. They did not react so swiftly or dramatically to earlier outbreaks like SARS, swine flu, avian flu and etc. They had prior knowledge of the potential of nCov2019. The US did not. Why do we have a National Security Council or a Department of Homeland Security if they cannot read the writing on the wall? It was an accidental release of a weaponized virus. The US should have taken a cue and reacted with similar conviction shown by the CCP. But we have no leadership worth a shit.

Our representative republic has suffered an embarrassment in this failure to protect the people while a so-called national enemy, a communist dictatorship, has demonstrated more effective leadership and greater capability to protect its people. This is more than an embarrassment. It is an indictment of our political system.

It is time to turn sharply left to social democracy.


Posted by: jadan | Mar 14 2020 2:45 utc | 187

I went through Trump's twitter account to see how much and when Trump considered coronavirus an issue of importance. Twitter entries only go back to feb 12th
Prior to 25th feb Trump's only mention was to thank Cambodia for taking in the Carnival cruise ship though he did not mention coronavirus. Started waking up to the approaching problem just a few days ago. No mention anywhere of hospital beds and ventilators which will be the main requirement.

@realDonaldTrump
Feb 25
The Coronavirus is very much under control in the USA. We are in contact with everyone and all relevant countries. CDC & World Health have been working hard and very smart. Stock Market starting to look very good to me!

Donald J. Trump Retweeted
@CDCgov
Feb 26
There is currently no reported community spread of #COVID19 in the US. People should follow everyday measures to prevent the spread of respiratory viruses, such as staying home when sick and washing hands with soap and water. Stay informed; visit http://cdc.gov/COVID19.

Donald J. Trump Retweeted
Sun with raysBrandon Beckham, Esq.
@BrandonBeckham_
Feb 29
Dr. McCormick @RichforGA a Medical Doctor & Decorated US Marine @USMC
provides a much needed perspective concerning #Coronavid19
(video retweeted by Trump. Wash your hands and you will be just fine)

Donald J. Trump Retweeted
Trump War Room - Text EMPOWER to 88022
@TrumpWarRoom
Mar 2
Health and Human Services Secretary Alex Azar on the Coronavirus:
"The risk to average Americans remains low. We are working to keep it low."

@realDonaldTrump
Mar 2
I am meeting with the major pharmaceutical companies today at the White House about progress on a vaccine and cure. Progress being made!

Posted by: Peter AU1 | Mar 14 2020 2:48 utc | 188

Civilizations depend on toilet paper it seems. Toilet paper is the bellwether commodity of our age. Capacity production is called for, especially neoclassic econ 101 foolishness. Nevertheless, overtime at the paper mills is in order.

Posted by: UnionHorse | Mar 14 2020 2:48 utc | 189

@180 JW

Yes, the IRS works well with tongue in cheek (while the military doesn't work well for anyone on earth). I watch a lot of old Hollywood movies, and it's insane how Hollywood normalized the income tax with their propaganda. Another thing that the government did suspiciously well was changing TV to digital. Their programming screen is a very important thing for them;)

Posted by: SharonM | Mar 14 2020 2:50 utc | 190

jadan

China made a few missteps at the start so its doubtful they knew what they were dealing with at the start other having a sudden batch of pneumonia due to a newvirus. They reacted the same as any rational well organised country would react.
As to China being the only country aware of the potential - every institution in the world would have been studying coronavirus after MERS and SARS. Some purely to defend against outbreaks, others to weaponize it.

Posted by: Peter AU1 | Mar 14 2020 3:00 utc | 191

@Disabused | Mar 14 2020 2:54 utc | 191

Is the USA so cursed that Biden & Co is all they can come up with as an 'alternative' in this class war?

Down "Memory Lane" for a laugh...

"So Long To Ya, 2010" | The JibJab 2010 Year in Review!

https://www.youtube.com/watch?v=CCuoLd0K4lY

Posted by: imo | Mar 14 2020 3:23 utc | 192

Disabused | Mar 14 2020 2:54 utc | 191

Actually, Biden would be the 2nd Alzheimer's President. Trump is a Psychopath but doesn't have Alzheimer's.

The first Alzheimer's President was Ronnie Raygun, who died of Alzheimer's. During his reign of terror, he gave us today's homeless by emptying out and shutting down mental hospitals so the those with severe mental problems had nowhere to go but live on the street. They soon will probably be a transmission belt for the coronavirus.

Posted by: heresy101 | Mar 14 2020 3:57 utc | 193

douglass truth | Mar 13 2020 15:30 utc | 18:
arby | Mar 13 2020 19:35 utc | 94:

For those getting the "file not found" error from douglass truth @ 18 link, Stacey Reiman provided a link to a PDF version of it: Notes from a UCSF panel

The PDF seems to be cutting off some info at the top header; no idea if important.

Posted by: Ian2 | Mar 14 2020 4:05 utc | 194

LOL, I retract my positive impression about the UK's handling of this, they are letting it go wild to build up "herd immunity".

Holy fuck, Boris is mishandling this shit on an epic proportion.

Posted by: Smith | Mar 14 2020 4:21 utc | 195

Some of the stories I hear in the media are very sad, like the elderly couple parked in their car at the grocery, and too scared to go inside. I fail to understand how someone gets to be elderly but manages to avoid adversity, grief, loss, suffering. How can a person be old but so afraid of death?

There are much worse adversities than stocking up on food and staying in, like my neighbor who was shot by his partner and nearly died, or another neighbor whose husband was extremely ill *for years* and needed lots of care while she still had to work full time and look after her chronically ill daughter. It was probably a blessing when he finally died and his suffering ended. And so it goes. It is the same for nearly everyone everywhere, I should think. Are US peons really so coddled and helpless? Maybe it is mostly the city slickers...

Buck up, People! Perhaps a dose of Hank Williams Jr would help: "A Country Boy Can Survive"

Yes more people than usual will get sick and die this year and that is sad but people are slowly working towards a reasonable response even as Dear Leaders are leading from behind, as usual. Just as we saw with the AIDS crisis, official inaction and incompetence leads to avoidable suffering and death, but eventually officials will get pushed into taking some useful actions, if there is an independent movement to do the pushing.

I am disturbed that Fauci, a top leader at NIH during the AIDS crisis, is still in charge of his institute and seems to have taken over from his boss NIH Director Collins. Fauci appears to have learned little about managing a health crisis although he has been at NIH for *fifty years*. When will we take a steam hose to CDC, NIH, FDA, etc. and clean out the rot and the deadwood?

Posted by: Trailer Trash | Mar 14 2020 4:29 utc | 196

"My first outline says that these will be huge and will reverb over several decades. I will have to tone that down."

Coronavirus has the possibility of being some sort of a game changer but as for reverb over several decades, people in the west in general have the attention span of goldfish. Once the worst of it has past, the survivors attention will be taken up the latest iphone or whatever other useless gadget it the latest fashion .

Posted by: Peter AU1 | Mar 14 2020 4:42 utc | 197

Ian2
I believe that sort of thing is now classified information in the US. Can't have panic in the stock markets I guess.

Posted by: Peter AU1 | Mar 14 2020 4:48 utc | 198

@ Walter 174

Are you not applying the fallacy of implication? Who is this 'man' boiling water and why is he? You are eliding the fact of evidence of boiling water with your interpretation of some underlying intention. That's a very dangerous leap.

Posted by: Patroklos | Mar 14 2020 4:55 utc | 199

Trump's priorities.

"@ejmalrai
World: keep a record of this.
The planet is in a state of emergency and solidarity to fight against a pandemic and the #US is thinking about war, sanctions and patriot system.
Beyond belief."

But then US has always attacked the civilian population of target countries.

Posted by: Peter AU1 | Mar 14 2020 4:58 utc | 200

« previous page | next page »

The comments to this entry are closed.