Moon of Alabama Brecht quote
February 05, 2016

The Zika Virus Is Harmless - Who Then Benefits From This Media Panic?

The media are currently creating a panic about the allegedly dangerous Zika virus:

There is absolutely no sane reason for this panic campaign.

The virus is long known, harmless and the main current scare, that the virus damages unborn children, is based on uncorroborated and likely false information.

A recent Congressional Research Service report (pdf) about Zika notes:

Zika is a virus that is primarily spread by Aedes mosquitoes [..]. Zika transmission has also been documented from mother to child during pregnancy, as well as through sexual intercourse, blood transfusions, and laboratory exposure. Scientists first identified the virus in 1947 among monkeys living in the Ugandan Zika forest. Five years later, human cases were detected in Uganda and Tanzania. The first human cases outside of Africa were diagnosed in the Pacific in 2007 and in Latin America in 2015.

The thing is just one of many thousand viruses that can effect humans. It is known. It is rather harmless. It effects, if there are any at all, are very mild:

A relatively small proportion (about 1 in 4) of infected people develop symptoms. The virus is only detectable for a few days in infected people's blood. [..]

Zika typically causes mild symptoms, including fever, rash, and conjunctivitis, which usually last up to one week. Hospitalization and death following infection are rare.

Only 1 in 4 infected people are affected and any typical flue would be more aggravating to them than this little bugger.

BUT WHAT ABOUT THE CHILDREN????!!!!

The CRS report says:

Health experts are uncertain whether Zika causes microcephaly, a potentially severe birth defect involving brain damage. Since October 2015, Brazilian officials have reported more than 4,000 cases of microcephaly in areas with ongoing Zika transmission, up from roughly 150 cases in previous years. Health officials are concerned that this may be a result of infection in the fetus when a pregnant woman is infected.

Synopsis: We do not know if the virus harms unborn children children at all. But that number of 4,000 cases looks suspiciously high.

That is because it is false.

Microcephaly, the so called "pinhead", is not easy to diagnose. There is no standard or certain border value for the size of a newborn baby that doctors can agree on. A baby head may look too small and develop perfectly well or it may look too small and not develop perfectly. Not every case gets regularly reported. There are possible structural reason why this years number differ a lot from last years numbers. A new doctor? A new reporting system? Changed diagnosis guidelines? We do not know.

What we know is that the 4,000 cases number from Brazil that is circulating is a. misleading, b. wrong and c. unrelated to the virus.

The number is misleading because it does not give any real base like the total number of birth to which those 4,000 cases relate. According to a 2009 paper published in Neurology and quoted here:

“Microcephaly may result from any insult that disturbs early brain growth [...] annually, approximately 25,000 infants in the United States will be diagnosed with microcephaly .."

Hundreds of children are born with microcephaly every day. That is sad. But it also tells us that the "big number" of 4,000 is not really that high.

It is also false.

As was reported already a week ago:

New figures released Wednesday by Brazil's Health Ministry as part of a probe into the Zika virus have found fewer cases of a rare birth defect than first feared.

Researchers have been looking at 4,180 suspected cases of microcephaly reported since October. On Wednesday, officials said they had done a more intense analysis of more than 700 of those cases, confirming 270 cases and ruling out 462 others.

So more than half of those 4,000 children reported with microcephaly do not have microcephaly. That the numbers now see such a sharp correction points to problems in the standard of diagnosis in Brazil and elsewhere. Are we sure that we have really correct numbers for earlier years to compare with the current numbers?

But what about that dangerous virus?

Six of the 270 confirmed microcephaly cases were found to have the virus. Two were stillborn and four were live births, three of whom later died, the ministry said.

Only 6 out of 270 were confirmed to have had the virus. Is that a reason to be scared? Or not? That number only tells us that the detection of this virus is rare. It does not tell us how many of the 270 have at a time been infected. It also does not tell us if such an infection has caused microcephaly or not.

But you want another scary headline? "Five out of six kids diagnosed with Zika virus died!!!"

That headline is of course also wrong. We do not know how many, if any, of the surviving kids once had the virus and got rid of it. When were those tests done? Remember that the CRS report noted:

The virus is only detectable for a few days in infected people's blood.

It is likely that the virus can be detected in a dead human body if that body was infected at the time of the death. But in a living body with a working immune system the virus will have vanished after just a few days. It is quite possible that a whole bunch of the surviving children once had the virus, that it caused no harm, and that it vanished.

There is absolutely no sane reason for the scary headlines and the panic they cause.

The virus is harmless. It is possible, but seems for now very unlikely, that it affects some unborn children. There is absolutely no reason to be concerned about it.

As this is all well known or easy to find out why do the media create this sensation?

Cui bono? Has someone a vaccine they want to sell? Is this to damage Brazil's Olympics?

Feel free to speculate.

Posted by b on February 5, 2016 at 03:25 PM | Permalink

Comments
« previous page

I already predicted your objections when I posted it.


Posted by: dh | Feb 6, 2016 9:28:53 PM | 96

No you didn't, you certainly didn't mention the complete lack of a soundtrack - which someone had to actually go to the bother of removing from the video in the first place - now why would someone go to all that effort in order to remove the soundtrack from the video before posting it unless they are trying to mislead?

But it does appear you already knew it was unverifiable no-soundtrack crap before you posted it, so why bother posting it?

Posted by: Hoax? | Feb 6, 2016 9:40:50 PM | 101

https://www.youtube.com/watch?v=dGMSO1M0W00

Posted by: dh | Feb 6, 2016 9:37:16 PM | 99

More non-Koln crap - why do you keep posting crap that has nothing to do with the matter under discussion?

It makes you look very very dishonest

Posted by: Hoax? | Feb 6, 2016 9:42:54 PM | 102

so despite dh's very valiant attempts to drown us in obviously dishonest crap, so far no one has been able to supply any video showing the alleged events in Koln

Why dh is so determined to drown us in obviously dishonest crap is a bit of a mystery. Maybe he's a racist, I don't know, but it sure is curious

Posted by: Hoax? | Feb 6, 2016 9:46:20 PM | 103

"teratogenic effects of in utero exposure at Hiroshima and Nagasaki, microcephaly and mental retardation, have been observed"
https://inis.iaea.org/search/search.aspx?orig_q=RN:35070425

"The Washington State Health Department is trying to identify the cause of an unusually high number of rare birth defects in south central Washington, around the leaking Hanford nuclear site. In 2013, seven cases of anencephaly, a rare and often fatal birth defect were reported in a remote region of Washington State, clustered around the Hanford site."
http://nsnbc.me/2014/04/24/400-spike-in-rare-birth-defects-near-leaking-hanford-nuclear-site/

Researcher finds Chernobyl birds have smaller brains
phys.org › Biology › Plants & Animals
Feb 11, 2011 - Twenty-five years after the Chernobyl disaster, re bird brain size: “Mousseau said not only are their brains smaller" .... “These findings point to broad-scale neurological effects of chronic exposure to low-dose radiation,” Mousseau said. “The fact that we see this pattern for a large portion of the bird community suggests a general phenomenon that may have significant long-term repercussions.”
Mousseau said these types of defects have been previously reported in humans and other organisms, but those were at higher contamination levels.

Read more at: http://phys.org/news/2011-02-chernobyl-birds-smaller-brains.html#jCp
http://phys.org/news/2011-02-chernobyl-birds-smaller-brains.html

Given near 5 year ongoing Fukushima radiation, and our increasingly radioactive circumstance, and the recent demise of much of the life of the North Pacific Ocean, perhaps the new viral fear phenom is also a sleight of hand diversion? I mean, we wouldn't want to give our 'too cheap to meter' wonderchild an unsavory reputation.


Posted by: canuck | Feb 6, 2016 9:46:59 PM | 104

@100 I never noticed the soundtrack to be honest. But you can believe what you want.

You obviously think young muslim men in a pack are incapable of groping Western women.

Let's just leave it at that.

Posted by: dh | Feb 6, 2016 9:47:40 PM | 105

@100 I never noticed the soundtrack to be honest. But you can believe what you want.

You obviously think young muslim men in a pack are incapable of groping Western women.

Let's just leave it at that.

Posted by: dh | Feb 6, 2016 9:47:40 PM | 104

now you're just lying - I never said nor implied anything of the sort

maybe dh is shorthand for "DisHonest"?

Posted by: Hoax? | Feb 6, 2016 9:50:19 PM | 106

@105 So you do think young muslim men have problems dealing with unveiled women?

Posted by: dh | Feb 6, 2016 9:53:24 PM | 107

I think you have problems

Posted by: Hoax? | Feb 6, 2016 9:56:22 PM | 108

@107 Well everybody has problems. How about a straight answer to my question?

I lived for several years in Arab countries BTW. Iraq and Kuwait specifically. So I'm fairly familiar with attitudes towards unveiled women.

Posted by: dh | Feb 6, 2016 9:59:08 PM | 109

next you'll be telling us you were also in the Koln Haupbahnhof on NYE.

Posted by: Hoax? | Feb 6, 2016 10:03:42 PM | 110

http://edition.cnn.com/2016/02/06/europe/cologne-reporter-groped/index.html

that's a CNN report of an (Unveiled!!!) Belgian Female TV reporter in Koln this week, being groped by a German Male of european extraction - on LIVE TV.

Posted by: Hoax? | Feb 6, 2016 10:11:37 PM | 111

Hoax, you're saying what I've been thinking.

dh, I understand your wanting to defend yourself from Hoax's critical replies. But, Hoax's request is pretty straight forward: "for heaven's sakes, will someone show me some actual video evidence??" It seems no one can find anything remotely authentic and compelling.

Posted by: dumbass | Feb 6, 2016 10:11:41 PM | 112

@109. Now you're just wasting everybody's time.

You were suggesting that the sexual assaults by young muslim men in Koln were a hoax. I can excuse some of it as cultural misunderstanding but I tend to think they happened. I guess that makes me a racist.

And I still want you to tell me if young muslim men have problems dealing with unveiled women.

Posted by: dh | Feb 6, 2016 10:11:43 PM | 113

@111 I agree with that. There's no video just word of mouth evidence. But that doesn't make the Koln events a hoax.

Posted by: dh | Feb 6, 2016 10:13:55 PM | 114

there's even a video to go with it - https://www.youtube.com/watch?v=HSHINmAAgts

Astute observers (not dh obviously) will note that this video is not some unverifiable no-soundtrack crap, and has not had the soundtrack deliberately removed beforehand, in order to mislead

Posted by: Hoax? | Feb 6, 2016 10:17:23 PM | 115

@114 Well done. You found a drunk German idiot.

Posted by: dh | Feb 6, 2016 10:20:52 PM | 116

>> It seems no one can find anything remotely authentic and compelling.

I should add: "That's no reflection on you."

>> I still want you to tell me if young muslim men have problems dealing with unveiled women.

"Muslim men" is a pretty broad brush, which makes me wonder about your analysis. Are these "Muslim men" from countries where it's not required? Who knows and by how much?

I know this is the "court of public opinion" and we don't employ the rules of evidence rigorously. But, if we citizens don't demand to see some evidence, why do we even need a brain? From now on, let's believe everything we're told or on the basis of social proof.

Hoax and I expect evidence that could be supplied easily given the claims of rampant problems. Its absence -- like the absence of decent evidence about WMD -- raises alarm bells.

Posted by: dumbass | Feb 6, 2016 10:22:16 PM | 117

@109. Now you're just wasting everybody's time.
Posted by: dh | Feb 6, 2016 10:11:43 PM | 112

You're the one posting unverifiable no-soundtrack NOT-Koln crap - not me.

As has already been stated, it's a pretty straight forward request: "for heaven's sakes, will someone show me some actual video evidence??"

You decided to waste everyone's time first by posting a laughably age-restricted unverifiable no-soundtrack crap video and then following up with a video from Egypt which even you should have been able to identify as "NOT Koln"

And then you accuse ME of wasting people time?

Like I said earlier - you clearly have problems

Posted by: Hoax? | Feb 6, 2016 10:23:36 PM | 118

dh, hoax, It's been good chatting with you. I'm going get my butt out of this chair. Good night.

I don't think we're going to make any progress on this "evidence" issue. I also suggest you two not continue arguing over the apparently "impossible mission" of finding evidence here. When the authorities are dis-servicing us, we shouldn't take it out on each other. Besides, there's lots more to talk about another day.

hoax, thanks for saying what's been on my mind about these events. What few "videos" seem to be blown out of proportion. It's just been "too convenient" a mechanism to ratchet up the tension (wind people up) and to distract.

Posted by: dumbass | Feb 6, 2016 10:27:43 PM | 119

@114 Well done. You found a drunk German idiot.

Posted by: dh | Feb 6, 2016 10:20:52 PM | 115

So according to dh: when a German male gropes a woman on LIVE TV that's just "some drunken idiot" but when Muslim men are accused of doing the exact same thing well THAT is reason to condemn all Muslim men everywhere?

Like I said - YOU clearly have problems

Posted by: Hoax? | Feb 6, 2016 10:27:50 PM | 120

@120 I'll be happy to stop and I'll admit hoax? has a point about the absence of videos. Seems the video I posted was from Egypt a few years ago. My bad. I'm sure those Egyptian men have seen the error of their ways.

I don't 'condemn all Muslim men everywhere' for what happened (or didn't happen) in Koln. Just the ones who did (or didn't) do the alleged groping. The hoax as you call it.

I still think there are basic cultural differences at play here that won't be resolved with a bit of whitewash.

Posted by: dh | Feb 6, 2016 10:39:52 PM | 121

So when 3 German males shimmy up behind a woman to sexually harass her, and one of them actually sexually assualts her on LIVE TV, that's just "some drunken idiot".

However when Muslim men are accused of identical misbehaviour that apparently indicates "basic cultural differences at play"?

Here's what you actually (repeatedly) said

"young muslim men have problems dealing with unveiled women.
Posted by: dh | Feb 6, 2016 10:11:43 PM | 112"

So no, you didnt condemn "ALL muslim men everywhere", just all the "young muslim men" everywhere. And when shown actual evidence of a group of young German men sexually harassing and assaulting a Belgian woman you immediately tried to dismiss it as just "some drunken idiot".

Careful there dh, your bigotry and racism are showing.

(Or maybe it's just a "basic cultural difference", and in your culture blatant hypocrisy racism and bigotry are a "cultural norm"?)


Posted by: Hoax? | Feb 6, 2016 11:10:24 PM | 122

Why on earth would you post the video in the first place dh, if you knew it was from Egypt a few years ago? Just to prove "it's possible"?

"It's possible" that "Arab men" grope "unveiled women"? Seriously what is your point? It seems like nothing more than racism, especially with the added flair of "I used to live there, so I know just how out of control those arabs can get around a blonde woman wink wink".

Posted by: L Bean | Feb 6, 2016 11:11:34 PM | 123

123

Yeah, cos White german males of Christian heritage would obviously never dream of sexually harassing nor sexually assaulting an unveiled blonde woman in public in the middle of Cologne, as the video posted at 114 so clearly proves.

Cos that, according the dh anyway, is obviously something their Christian cultural programming would not allow them to even think of doing.

I'm so glad that all white Christian men are not like all those smelly horrible filthy young muslim men (everywhere), that dh has so kindly identified for us as being severely culturally deficient when it comes to respecting the bodily integrity of blonde females in the middle of Cologne.

Posted by: Hoax? | Feb 6, 2016 11:28:44 PM | 124

Mr M.O.A you have your answer -

http://www.usatoday.com/story/news/2016/02/05/un-zika-affected-nations-must-increase-contraception-access/79869242/

UN Anti Abortionist agenda in the one region that has always resisted it yet has always made contraception accessible.

Posted by: Aleph | Feb 7, 2016 1:29:34 AM | 125

Hoax, I can guess what your religion and cultural background is. I am amazed at the level of denial in the Muslim community of this event, which guarantees that this will happen again.

Posted by: Mischi | Feb 7, 2016 1:41:22 AM | 126

@123 L.Bean You haven't been following. I didn't know the video was from Egypt when I posted it. I had googled 'Koln, muslims groping' and it came up. I have since apologized.

My time spent in Iraq working in the oil business was a very happy time. I have a lot of respect for Arabs and muslim culture.

But I know how difficult it can be for unveiled Western women.....especially blonde women. That's just a fact. And I think you know it too Hoax? You protest too much.

Posted by: dh | Feb 7, 2016 1:43:22 AM | 127

@ canuck | Feb 6, 2016 9:46:59 PM | 103

Another place where micro and an encephalopathy was noted was in the maquiladora region along the Mexican, U.S. border during the mid to late 1980's and early 1990's; thought at the time due to both industrial pollution and from known loss of medical radiologic materials in the recycling of medical equipment (recycling a cobalt laden item contaminated steel rebar reimported back into the U.S. about 1990's, (IIRC this was in the El Paso border region of Mexico). Serious public concerns in the media at the time (pre WWW).

Posted by: Formerly T-Bear | Feb 7, 2016 2:00:58 AM | 128

Posted by: Denis | Feb 6, 2016 3:17:04 PM | 76

Thanks for trying but your inability to translate biotech vernacular into accessible language creates a communication gap which can't be bridged from my side. After I posted my comment to you, I looked up Chromosomes (yr opening XX & XY gender ref) and Transposons, and those links were liberally sprinkled with jargon too. I'm reminded that Einstein was able to explain Relativity in circa 100 pages with language and models that even I could understand.

I'm concerned that if biotech experts (who are trying to explain a potential peril) can't make themselves understood, then we'll just have to wait until someone who can explain it happens along.

Posted by: Hoarsewhisperer | Feb 7, 2016 2:10:49 AM | 129

Can the jets be kooled about the video? It is obvious how easily information can easily be misinterpreted, misconstrued or misused for one agenda or another by the course of this commentary. The commentary also shows just how easy it is to misread another's written product and create implied motive that had not been presented directly. Use your opinions judiciously, everyone has the right to theirs no matter how misguided they might be - your opinion will never trump another's opinion no matter how loudly or long you try. Kool the jets - please.

Posted by: Formerly T-Bear | Feb 7, 2016 2:14:45 AM | 130

@129 hoarse

Try Pandora's box: how GM mosquitos could have caused Brazil's microcephaly disaster. The jargon in biotech ... in molecular biology ... is inescapable.

Posted by: jfl | Feb 7, 2016 2:28:12 AM | 131

Posted by: Denis | Feb 6, 2016 3:17:04 PM | 76

There's an interesting couple of notes at the end of Pandora's box: how GM mosquitos could have caused Brazil's microcephaly disaster that discounts the thesis of the article, although not the dangers of releasing "GE insects containing 'promiscuous' DNA sequences such as piggyBac".

Posted by: jfl | Feb 7, 2016 2:35:39 AM | 132

@ Hoax? | Feb 5, 2016 3:27:20 PM | 1

Like yourself, the reports out of Cologne about NYE cause unease. The video provided, repeated and endlessly looped does not show what the given narrative provides fertile grounds for - the disparagement of a segment of asylum seeking population, mostly by assertion, assumption and implication e.g. being male is automatically guilty of sexual misconduct.

What the provided video shows is only a public gathering of people having drink taken, loud, rowdy and roguish - exactly the behaviour of youthfulness on such occasion as the change of the year provides. Just the numbers of misdeeds alone should make the official narrative suspect and it would seem quite unlikely enough transient foreigner would be available to accomplish the alleged (a word sadly missing in the narrative) misdeeds. It is unlikely the numbers shown in the square if limited to natives alone would be sufficient to accomplish such misdeeds as were charged. The narrative is a cracked bell that does not ring true. Why? The use it was put reveals the answer best and most likely. There is a stench of Gulf of Tonkin coming from Cologne square, a narrative is superimposed over a misrepresentation of events to achieve some political purpose - in Cologne - to overturn Chancellor Merkel's open policy, roots and all, for an opposing agenda that had no effective traction hitherto. I don't think CCTV footage will be seen until such time it makes no difference - just my guess.

Posted by: Formerly T-Bear | Feb 7, 2016 3:25:32 AM | 133

dh @ 131.
Thanks, I'll take a look.
Jargon (1 word = 1 page) definitely speeds communication and saves time within a discipline but that's no excuse for it impeding communication at the expert/ novice interface.

Posted by: Hoarsewhisperer | Feb 7, 2016 3:35:21 AM | 134

Pardon me. jfl @ 131, not dh.

Posted by: Hoarsewhisperer | Feb 7, 2016 3:39:31 AM | 135

@ Hoarsewhisperer 129

Well, transposons or transposobale elements are jumping genes carrying their own scissor along (= transposase). They carry at both ends "recognition sites" (inverted repeats) which allows the element to insert itself into any genetic material (DNA) having the same "mirroring recognition sites", like a key (= the two inverted repeats brought together forming a ring-like structure) fitting into a keyhole (the mirroring recognition site). (Visually very very simplified it's like maybe one tiny soap bubble joining another soap bubble at a specific location thus leading to one bigger soap bubble).
As these recognition sites are very short, in case of the mentioned transposon of only 4 bases, the chance that the very same 4 bases occur somewhere else on the host's genetic material (even on viral genetic material) is not rare at all. I am not going into detail of the genetic code here. That you would have to look up.

Now, even if this transposon doesn't carry its own scissor, it can be cut out by the scissors of other occurring transposoble elements in that genetic material. Multiple transposons in genetic material are known for a lot of species. As there may occur errors in the insertion and cutting out process, it is quite possible that some transposable elements can carry along host genetic material and contribute thus to a horizontal gene transfer to other species. I hope this is an easy description of the process.

Posted by: Karin | Feb 7, 2016 3:47:13 AM | 136

Just fucking with the BRICS ahead of the Olympics. Order out of Chaos.

Posted by: rosco | Feb 7, 2016 5:24:23 AM | 137

b, 'why do the media create this sensation?'

Just to keep up the fear, uncertainty, doubt level? To make Brazil seem like a 'second-rate' state, in need of getting rid of its 'second rate' executive, as Argentina has done? To prep us all for pandemic diseases they have on the back burner? ...

Posted by: jfl | Feb 7, 2016 7:49:27 AM | 138

Susan Sunflower at 65, there must be a misunderstanding, I said nothing about the events in Cologne, and did not deny in any way what happened there. I did include ‘sex stories’ as something hyped by the media, hardly flash news! — tabloids count on it for sales. There is also a distinction between ‘hyping’ (I realise this word isn’t of the greatest clarity) and the truth or ‘realness’ of the events that occurred, but that would take long paragraphs, not useful. Re-reading my post, it wasn’t much good, RED PEN time.

Note, there is an important difference between the Cologne (and other locales) story and the coverage of Zika, which gives a different pattern, type, style, unfolding, of media stories and reports. The first are reports on events in the past involving human actors, thus in that sense regular fare for the media, whereas Zika is a topic not well understood (let’s say) by experts/Gvmts etc. and not within the range of comprehension of media hacks, who btw mostly can’t grasp even simple nos., stats, don’t know anything about viruses, etc. and love health scares even more than sex. So comparing is difficult..

Remember the Amerithrax events? Ppl in the US were going into survival mode barricaded into their homes and buying *duct tape* to seal their windows, doors, etc. Ok that had the added boost of ‘terrorist’ threat.

Anyone interested in health scares that are NOT reported might consider for ex. thyroid cancer. From Counterpunch (must be the first time I link to them!) Feb. 2016. http://bit.ly/1mlGJIk

Posted by: Noirette | Feb 7, 2016 8:58:13 AM | 139

@ToivoS | Feb 6, 2016 3:47:49 AM | 49

I think you are on to something. According to the CDC if my math is correct the range of occurrence of baby's born with microcephaly is in the range of 400-4000 yearly in the US, not 25,000.

"Microcephaly is not a common condition. State birth defects tracking systems have estimated that microcephaly ranges from 2 babies per 10,000 live births to about 12 babies per 10,000 live births in the Unites States"

http://www.cdc.gov/ncbddd/birthdefects/microcephaly.html#ref
http://www.nbdpn.org/docs/bdra23198.pdf

Posted by: notlurking | Feb 7, 2016 10:02:03 AM | 140

Posted by: Karin | Feb 7, 2016 3:47:13 AM | 136

Thanks for your effort in providing a simplified answer to the question I posed to Denis. I realise(d) that the nature of jargon makes it impossible to find a common word to replace a single word of jargon, and I appreciate the time you spent on the "translation." I now feel that I'm on the threshold of understanding how piggyBac might be viewed as a less-than-perfect path to a GM mosquito with benign and predictable characteristics.
Thank you again.

Posted by: Hoarsewhisperer | Feb 7, 2016 10:09:39 AM | 141


@ Debs is dead | Feb 6, 2016 5:23:59 PM | 82

Actual quote: "I dunno you Denis, I dunno if yer a regular or a blow in just dropping by to disseminate lies"

Actual response: Whew! You really got yer panties in a twist there, dude. Appears that you don’t like to be called out for trying to punk us with your false microcephaly case numbers computations, as I explained at 76.

You’re entitled to whatever opinions you want to peddle; it’s America. But you’re not entitled to peddle false facts without expecting some push back.

- - - -

@Susan Sunflower | Feb 6, 2016 5:41:31 PM | 83

You quote VOX, a site that often causes me mild heartburn. I don’t know who those people are, but they write like the same high school kids HuffPo hires. The quote you give is a good example:

"As best researchers can tell, the virus clears itself from the body pretty quickly . . ."

No, the virus does not "clear itself from the body." I don’t know of any microorganism that "clears itself from the body." The immune system clears the virus. The VOX quote sounds like a misconception from someone who slept through their high school biology lectures.

You make the point:
"(so having had Zika eliminates later problems)"

Such an important point, if I get what you’re saying. I haven’t seen any discussion on the acquired immunity of ZV or the interaction, if any, between acquired immunity and the ability of these jumping genes to propagate inside the host.

- - - -

@ wendy davis | Feb 6, 2016 6:41:46 PM | 85

Thanks for putting up good links to Dr. Ho’s articles.

The second link cuts off the dialog between Ho and Paulo Andrade, which is very interesting for those who are into the details. At one point they argue about these transposons jumping from animals to plants, which, to me, is as about as wild as biology could possibly get, and the possible implications for our new Monsanto/GM World (tm) gives me hives.

Let me try again to put up a good link to that second Ho article:

http://www.i-sis.org.uk/Beware_the_New_Breakthrough_Transgenic_Mosquitoes.php

I love this blog format, but that template above the comment box for blocking out links is diabolical. If you write a comment on a word processor, you have to go back and replace the quotation marks in the link template after you cut/copy to the comment box.

- - - -
@ Hoarsewhisperer | Feb 7, 2016 2:10:49 AM | 129

"Thanks for trying but your inability to translate biotech vernacular into accessible language creates a communication gap which can't be bridged from my side."

You’re welcome.

"I'm concerned that if biotech experts (who are trying to explain a potential peril) can't make themselves understood, then we'll just have to wait until someone who can explain it happens along."

I agree, and you will be relieved to know that your comment has convinced me to give up on my book project: "PiggyBac, Brazil, and OX513A for Dummies". It wasn’t working out very well anyway. The editors explained that those books are meant to be written for dummies, not by them.

Karin did a much better job:
Karin | Feb 7, 2016 3:47:13 AM | 136

But I would offer this point regarding the complexity: It amazes me no end how this incredible complexity – i.e., all of biology – arises from nothing more than a conceptually simple linear arrangement of 4 DNA bases – AGCT. For instance, here is the sequence of the first 50 or so bases for one strain of ZV. The complete genome for the entire organism can be printed out in 9pt type on one sheet of paper.

agtatcaacaggttttattttggatttggaaacgagagtttctggtcatg . . .

http://www.ncbi.nlm.nih.gov/nuccore/KJ776791

I can understand how the A’s and T’s are connected and the C’s and G’s, and their parsimonious, wee hydrogen bonds, and the nifty biochemistry that puts it all together and converts it to proteins, and all that. I’m cool with that because I can follow the pictures in the textbooks. But to extrapolate from textbook understanding to the actual reality of all of biology, or even to a single, simple organism, and to contemplate the immense numbers of correct AGCT sequences (i.e. genes) that make it all work . . .well, it just makes me glad pot is finally legal in Washington or I would never hope get this worked out in my head.

- - - -

@ jfl | Feb 7, 2016 2:35:39 AM | 132

Good eye.

For those who haven’t read the article jfl links to, Tickell, the author, has appended a note by David Murphy, who compared the base sequence of the ZV from 2006 with 4 strains found in Brazil in 2016.

Murphy is saying if the hypothesis about piggyBac is good, you should be able to find traces of it in the 2016 ZV sequence but not the 2006 sequence.

And he doesn’t find it in either one.

But he doesn’t say anything about those 2016 ZV samples, like whether they came from patients, or regions where OX513A was released, etc. But he may well be onto something. It’ll be an all-day project just trying to figure out what Murphy actually compared and checking the sequences. So much for the Super Bowl.

Posted by: Denis | Feb 7, 2016 11:14:02 AM | 142

A, for the most part, profound example of the High Worth of MoA. The discussion has brought out a virtual treasure from the net of minds and knowledge that gravitate and expostulate here.

To the point. At #9 I postulated that the sudden plethora of media attention to Zika was probably a coverup for something that diverted attention from what was paramount for some vested interest who’s exploits had run amuck. After reading and digesting (somewhat) the discussion here I feel in a better to offer more than just speculation and supposition.

One of the most intentionally obfuscated subjects on today’s radar is the GMO debate. For good reasons. Huge investments and commitments for a most shaky and potentially disastrous products on the corporate agenda. GMO’s, contrary to popular opinion and corporate propaganda in the USA, are not on the market because of scientific and government (FDA) acceptance of their safety but because the FDA covered up warnings of their own scientists, misrepresented facts and fraudulently violated explicit mandates of U.S. law. The details can be found in a meticulously documented book by Steven M. Drucker (the lawyer who sued the FDA in regard to admittance of GMO’s on the U.S. market and received 44,000 of pages of the FDA’s documentation of GMO’s), Altered Genes, Twisted Truth.

The bottom line in regard to this thread and discussion is that GMO’s can express in countless unknown ways especially when considered in the light of “Jumping Genes”. I take away form this present discussion that GMO’s are implicated in the possibilities of the present media diversions of the Zika issue and that the vested corporate interests have significant reason to downplay their involvement.

By the way, the very first food supplement to be released into the market, L-tryptophan, that was produced by GMO technology was responsible for an epidemic that affected 5000 to 10000 people including 80 deaths and 1500 permanently disabled.

Posted by: juannie | Feb 7, 2016 12:51:30 PM | 143


The bigoted hypocritical racist "Mischi | Feb 7, 2016 1:41:22 AM | 127" earlier claimed to have seen video evidence of a father/daughter pair being sexually assaulted, but when repeatedly asked to provide a link to this alleged video evidence which the bigoted hypocritical racist "Mischi" insists he has seen, the bigoted hypocritical racist "Mischi" continues to refuse to provide any.

And when the bigoted hypocritical racist "dh | Feb 7, 2016 1:43:22 AM | 128" is asked to provide evidence of videoed sexual assaults, he too cannot provide any such evidence, instead providing video which he already knows is NOT from Koln NYE 2015 but from egypt 20011, yet still insists that he is sure these alleged thousand or more sexual assaults occurred just as the rotten German media reported them.

When both of the bigoted hypocritical racists "Mischi" and "dh" are shown actual video evidence of White Christian German men sexuality assaulting an unveiled (!!!) Blonde Belgian woman right in the middle of Koln, in broad daylight, a mere 3 or 4 days ago, neither "Mischi" and "dh", these 2 bigoted hypocritical racists earlier so full of righteous-indignation for the bodily integrity of unveiled blonde women in Koln, have anything meaningful to say on the subject, other than the bigoted hypocritical racist "dh" (DisHonest?) pathetically and hypocritically trying to dismiss it as mere "drunken idiocy."

Where is the evidence of these thousand or so sexual assaults? We live in the age of social media. It is strains credibility well beyond breaking-point that there are NO videos or Tweets or whatever of these thousands or so alleged sexual assaults.

There were at a minimum 10's of thousands of people in Koln, Hamburg and Helsinki carrying video-recording devices (and Gov't tracking devices, but that's another story) in their pockets on NYE yet over a month later, not one verifiable video of any of these alleged sexual assaults has appeared.

So, where is the evidence?

Show it, or shut up, "Mischi" and "dh", you pair of bigoted hypocritical racists.

Posted by: Hoax? | Feb 7, 2016 12:51:31 PM | 144

The hysteria wrt Zika is necessary to demand compliance with what is the current public health response / advisories which
in turn are meant to avoid Ziko infected HUMANS being the vectors -- infecting Mosquitos, who would then spread Zika to more humans, who would infect more mosquitos to eventually create a pandemic. I'm suspect this public health effort is doomed.

It relies on individuals (#1) avoiding getting bitten by mosquitos via the use of repellents and window screens, etc. and the (#2) elimination of mosquito breeding wet areas. I'm not sure what the "goal line" is in this scheme.

Advising people to not get pregnant for a couple years, would appear to be temporizing until a preliminary vaccine might be ready, although as far as I can tell, a certain degree of herd immunity (including of would-be pregnant women) would have been achieved by then. Zika has been and will continue to be a "poor person's disease."

The government apparently is not handing out unlimited amounts of repellent, and poor people who can barely afford to keep a roof over their head and their children fed, are unlikely to be "consistent" in their use of same. One English-speaking woman interviewed said she was spending around $50 a month on repellent. Demanding squatter communities to "take care of" mosquito abatement or wait until the government gets around to their district or block, again recipe for failure. The high density of the favela is challenge enough. In contrast, wealthy people can clear their property of standing water and ensure their screens are maintained and order unlimited repellent from Amazon.

FWIW, Vox was the only article I read that specifically addressed that question which I had asked earlier.

Since the same mosquito is implicated in spreading both Dengue and Chikungunya, significantly more serious diseases, I'm guessing the government is in full-panic mode. Imagine the hysteria and anger at the government if it were Dengue or Chikungunya instead. Sounds to me like Zika 2016 is demonstrating how those diseases might spread.

Posted by: Susan Sunflower | Feb 7, 2016 12:57:18 PM | 145

@145 Wow....looks like we have a real one-trick pony.

Posted by: dh | Feb 7, 2016 12:57:38 PM | 146

@123 L.Bean You haven't been following.

Posted by: dh | Feb 7, 2016 1:43:22 AM | 128

No - L.Bean was following your line of argument perfectly - the 2nd video you posted? you knew damn well that was not from Koln 2015.

As for the first video with no soundtrack whatsoever, - you clearly didn't care whether or not it was from Koln NYE and just posted it because you thought it would help you slander all young Muslim men (everywhere) as rapists and a danger to Blonde Women in Koln.

Your blithe dismissal of the exact same misbehaviour, as mere "drunken idiocy", carried out by white Christian German men a mere 3 or 4 days ago in almost the exact same location as the alleged sexual assaults on NYE, is all one needs to identify you as the bigoted hypocritical racist you so clearly are.

Unverifiable allegations of young Muslim men misbehaving? - A serious event that demonstrates the deficiencies of young Muslim men (everywhere), according to "dh".

White Christian German men verifiably misbehaving? Nothing but high jinks, Nothing to be alarmed by, mere "drunken idiocy", according to "dh".


A more classic example of bigoted hypocritical racism would be hard to find

Posted by: Hoax? | Feb 7, 2016 1:05:39 PM | 147

@145 Wow....looks like we have a real one-trick pony.

Posted by: dh | Feb 7, 2016 12:57:38 PM | 147

better a one-trick pony than a verifiable bigoted hypocritical racist

Posted by: Hoax? | Feb 7, 2016 1:06:38 PM | 148

wrt Videos - Pam Geller (professional Islamophobe) maintained that the Evil Merkel ordered all the CCTV videos ERASED ... because .... ummmmm (Since there are trials pending of people (allegedly) identified from those videos, such a move seems both extremely unlikely politically, impossible to keep "secret" in the long run). Personal guess is that whatever videos might exist that show "something" are not being "made viral" to protect identity of victims and perpetrators -- although given that it was after midnight in January, I wouldn't expect to see much, even if some women reported having their shirts torn off. Again, reportedly, some videos were found on the cell-phones of those arrested/in custody -- those apparently have not been released for public consumption (conspiracy!!!! we have a right to see everything!!!) ...

Posted by: Susan Sunflower | Feb 7, 2016 1:06:48 PM | 149

@149 Right you've sure got me pegged. Just another lying racist with no sympathy for gropers. Why would you even want to talk to me.

Posted by: dh | Feb 7, 2016 1:11:11 PM | 150

wow - a 3rd hypocritical bigoted racist has joined the fray

Susan Sunflower (SS) having been twice already asked to provide links to videoed evidence she claims to have seen, also continues to refuse to provide any, despite having 3 or 4 opportunities to do so, in her 3 or 4 comments on this matter.

SS wants to pretend that there were not 10's of thousands of video recording devices in the possession of members of the public on
NYE in Koln HH, and Helsinki.

SS wants to instead invent a conspiracy theory whereby the German Govt, or maybe even Merkel herself personally, has somehow prevented all those 10's of thousands of members of the public from uploading their videoed evidence, captured on their own personal video recorders.

The lengths that bigoted hypocritical racist like Mischi, dh, and SS will go to to keep alive their little bigoted hypocritical racist narrative of dangerous Muslims are quite pathetic

Posted by: Hoax? | Feb 7, 2016 1:18:09 PM | 151

@148 Do you mean this video?

https://www.youtube.com/watch?v=m7CoV0_jTbs

I already told you it has nothing to do with Koln. It's the Cairo squad.

Posted by: dh | Feb 7, 2016 1:22:31 PM | 152

Just another lying racist with no sympathy for gropers.
Posted by: dh | Feb 7, 2016 1:11:11 PM | 151

just another dishonest racist hypocrite with little to say, yet again, about the white germans confirmed sexually assaulting a blonde female, but with reams and reams of racist nonsense to say about mere allegations (unconfirmed) against young Muslim men.

Yes - definitely got you pegged, you little hypocritical racist.

Posted by: Hoax? | Feb 7, 2016 1:22:32 PM | 153

@154 What can I say about the white German gropers to keep you happy? They should be arrested and prosecuted for their disgusting behaviour. How's that?

Posted by: dh | Feb 7, 2016 1:28:34 PM | 154

Posted by: Denis | Feb 7, 2016 11:14:02 AM | 143

Sorry if you thought I was being brusque, or dismissive of your contribution here. That was never my intention. I try to keep my comments polite and brief but would be the first to admit that it's possible to have too much brevity and too few words.
Regards, HW,

Posted by: Hoarsewhisperer | Feb 7, 2016 1:37:01 PM | 155

Posted by: dh | Feb 7, 2016 1:11:11 PM | 151
or maybe a blinkered feminist chosing to believe the 500+ witness statements and complaints, even without publicly available youtube videos. ... because maybe it's all an Islamophobic hoax ... or some sort of politically correct cover-up ... or ??? alien attack?
BBC: 01/11/2016: Cologne attacks: New Year's Eve crime cases top 500two.
A German Russian teenager claimed to have been abducted and raped by an immigrant -- and later admitted it was all a lie (she was with her German boyfriend) ... obviously ....
not sarcasm, the Russian embassy was outraged that the Germans were ignoring the Muslim refugee threat -- they've got their own ax to grind ... dog to race.
http://www.cnn.com/2016/02/01/europe/germany-teen-migrant-rape-false/

The 13-year-old girl -- a member of Berlin's Russian-speaking community -- made the rape claim to police when she returned after a 30-hour absence last month. She alleged that three men of Arabic and Turkish descent had dragged her into a car at a train station and abused her.

Stories of the girl's ordeal circulated in Russian media and on social networks, prompting street demonstrations by Russian-German communities and right-wing groups.

Even Russian Foreign Minister Sergey Lavrov weighed in, accusing German authorities of a politically correct "coverup."

women, such troublemakers!

Posted by: Susan Sunflower | Feb 7, 2016 1:41:16 PM | 156

Posted by: dh | Feb 7, 2016 1:28:34 PM | 155

Far too late now, to try and run some damage control to distract from your little racist mess that you created all by yourself, dh.

You had ample opportunity to condemn, or even draw useful non-racist parallels between the behaviour of young german males and young muslim males, many posts ago.

You instead opted for continuing to attack and slander Muslims and Muslims only.

A more classic example of bigoted hypocritical racism would be hard to find.

Posted by: Hoax? | Feb 7, 2016 1:43:08 PM | 157

Russian embassy was outraged that the Germans were ignoring the Muslim refugee threat -- they've got their own ax to grind ... dog to race.

Posted by: SS | Feb 7, 2016 1:41:16 PM | 157

As have you, SS, quite clearly

Posted by: Hoax? | Feb 7, 2016 1:45:36 PM | 158

@158 Well at least I'm not a Trump fan.

Posted by: dh | Feb 7, 2016 1:45:39 PM | 159

160

probably another lie

Posted by: Hoax? | Feb 7, 2016 1:46:12 PM | 160

I've watched about a dozen videos most of which consisted of hard to decipher (where, when, who) crowds in bad lighting and many of which were spliced together from other videos I'd seen.

I've never claimed to see videos that proved anything ... but as I have argued, I don't think that's "proof" of anything for reasons I have cited.

As far as I was aware the "hoax" meme died a few days after the events ... first it was based on "why no arrests?" ...

Posted by: Susan Sunflower | Feb 7, 2016 1:48:16 PM | 161

Hoarsewhisperer @142 & Denis @143

Thanks a lot!
Yes, the complexity, for instance, of the human genome with 3 billion bases of ATCG's is amazing, and if you take into account epigenetic effects, it gets even more complex.

Denis let us know what you can dig up about David Murphy's findings.

Posted by: Karin | Feb 7, 2016 2:03:41 PM | 162

Posted by: Susan Sunflower | Feb 7, 2016 1:48:16 PM | 162

And yet having been asked repeatedly to provide a link to any of these alleged videos which you claim to have seen, you are completely unwilling or unable to do so.

Why anyone would go around claiming to have seen video of the events and yet refuse to provide a link to such evidence is a complete mystery.

Why would anyone do that, unless they have an axe to grind?

Posted by: Hoax | Feb 7, 2016 2:45:36 PM | 163

PS

everyone has already seen the video shot outside the Cathedral which completely disproves SS's nonsense about it being too dark for anyone to capture video.

We know for a fact that it was not too dark outside the Bahnhof for video capture, because pretty much everyone by now has seen the video shot outside the bahnhof, since be shown over and over on TV and all over the net.

So why SS continues to lie about it is a mystery. I guess SS thinks that if she continues to lie about it then people will somehow start to believe her lies.

Clearly SS, dh and Mischi have an agenda, and truth plays no part in it.

Posted by: Hoax | Feb 7, 2016 2:51:21 PM | 164

Oops, accidentally posted this on the wrong thread. Sorry for the double post.
The contents of the vaccination given the pregnant women. Note all the aluminum, which many doctors believe to be neurotoxic.
The report specified the Tdap produced by GlaxoSmithKline (GSK) of the United Kingdom as the one to be used. GSK has a technology transfer agreement with Brazil’s Butantan Institute for the production of the Tdap vaccine6 in Brazil.
Diphtheria toxoid—not less than 2 International Units (IU)
Tetanus toxoid—not less than 20 International Units (IU)
Bordetella pertussis antigen
Pertussis toxoid—8 mcg
Filamentous haemagglutinin—8 mcg
Pertactin—2.5 mcg
Adsorbed hydrated aluminum hydroxide (Al (OH ) 3) and aluminum phosphate (AlPO4)
Excipients: aluminum hydroxide , aluminum phosphate , sodium chloride and water for injection. Contains formaldehyde residues, polysorbate 80 and glycine1
---
http://www.thevaccinereaction.org/2016/02/tdap-vaccinations-for-all-pregnant-women-in-brazil-mandated-in-late-2014/

Note that a similar vaccination for pregnant women in US was begun in 2011.

Global Research article deals w the same http://www.globalresearch.ca/the-zika-virus-the-brazilian-microcephaly-outbreak-covering-up-another-latrogenic-disorder/5506097

Posted by: Penelope | Feb 7, 2016 10:10:19 PM | 165

I've had a look at the Portuguese sources of the microcephaly story. The number of cases is not coming from the media, but from the doctors and ministry of health. The ministry of health mandated the Tdap vaccination for pregnant women-- so it isn't surprising that they wd want to consider only Zika as the cause.

In all of 2014 there were less than 150 cases of microcephaly. http://yournewswire.com/is-zika-virus-or-the-dtap-vaccine-causing-birth-defects-in-brazil/ In December 2015, the Brazilian government declared an emergency after 2,400 Brazilian babies were found to be born with shrunken heads (microcephaly) and damaged brains since October.

FACT—The FDA has licensed Tdap vaccines to be given once as a single dose pertussis booster shot to individuals over 10 or 11 years old. The CDC’s recommendation that doctors give every pregnant woman a Tdap vaccination during every pregnancy—regardless of whether a woman has already received one dose of Tdap—is an off-label use of the vaccine.

FACT—Injuries and deaths from pertussis-containing vaccines are the most compensated claims in the federal Vaccine Injury Compensation Program (VICP) and influenza vaccine injuries and deaths are the second most compensated claim.

FACT—A 2013 published study evaluating reports of acute disseminated encephalomyelitis (ADEM) following vaccination in the U. S. Vaccine Adverse Events Reporting System (VAERS) and in a European vaccine reaction reporting system found that pertussis containing DTaP was among the vaccines most frequently associated with brain inflammation in children between birth and age five.

CDC recommended it to US pregnant women. Mfgr does NOT recommend it be used in pregnancy, but clearly they persuaded the Brazilian health ministry. I can't find an6y data as to whether US women got the Tdap, or whether there's any increase in microcephaly.

In Brazil, other neuro problems are emerging in some of the babies: eye problems, hearing, microcalcifications in the brain and muscular skeletal malformations. It appears that the 4,000 number is pretty close-- and more to come. It was about 10 months after the vaccination program that the ministry of health put out its emergency bulletin asking to be informed weekly of new cases. None of the other countries having Zika w or w/o the GM mosquito are reporting microcephaly as far as I can find.

Posted by: Penelope | Feb 8, 2016 12:14:34 AM | 166

Probably, the microcephaly cases are quite real. However, the link to zika-virus is weak, at best. There seems to be a link to the TDAP-vaccine program in latin-American countries. The zika-scare likely is to focus attention away from the vaccine causing microcephaly, and the potentially billions in damage-claims. http://www.trinfinity8.com/zika-virus-mosquitos/

Posted by: Alexander Grimsmo | Feb 8, 2016 12:48:09 PM | 167

>> I've watched about a dozen videos most of which consisted of hard to decipher (where, when, who) crowds in bad lighting and many of which were spliced together from other videos I'd seen.

That only elevates my suspicion.

After hearing from "eyewitness accounts" about Iraqi babies being thrown from incubators, my inclination is to distrust "data" that conveniently fans the flames of racist hatred -- a reliable theme for the "two-minute hate". When that "data" is unaccompanied by evidence you'd expect to come with it, to me that combination weighs in favor of concluding the *opposite* of what the "data" says.

Posted by: dumbass | Feb 8, 2016 1:05:20 PM | 168

@ dumbass | Feb 8, 2016 1:05:20 PM | 169

It is amazing that you have RT intensely covering the Cologne story since its inception, emulating immaculately their MSM counterparts, and the penny hasn't dropped that•this•is•how•propaganda•is•done.

Posted by: Formerly T-Bear | Feb 8, 2016 2:59:32 PM | 169

Cologne NYE observations:

Number and density of crowds: likely less than 10,000 tending toward significantly less on a wet, cold night. Density average appearing about a person each square meter tending towards two square meters. No overall establishing views of the whole plaza to indicate position and density of various knots of spectators to give perspective of the whole square and its distribution patterns. From shown videos there are various groups of greater density and open areas without people. People present appeared to be homogeneous in makeup. Recently arrived, transient people are not likely to remain in such an environment, only those accustomed by normal inhabitation would attend such celebrations.

Activities noted: some are involved in drinking, carousing, rowdyism, setting off fireworks and onlooking. If 400 to 500 attacks, assaults or rapes were taking place there would be a noticeable gathering of onlookers surrounding those activities - none were observed on provided videos - only in the accompanying narrative contained that information. The frequency of even 100 incidents would be evident in a 10,000 crowd looking for circus; claims of 4 or 5 times as many are not credible unless no question is asked.

Posted by: Formerly T-Bear | Feb 8, 2016 3:36:06 PM | 170

Didn't the groping scandal really took off when the authorities said that they had covered up reports?

I think that deserves some discussion as much as the lack of direct evidence. (I'm in USA so I didn't follow it that closely so I can't really add much. I think a German/EU citizen would have the most to add.)

Posted by: Jackrabbit | Feb 8, 2016 4:00:30 PM | 171

At risk of being called racist here are a couple of reports from Deutsche Welle. There have been 21 arrests so far. Presumably the German police have video evidence which they don't want to make public for fear of inflaming the situation...


http://www.dw.com/en/more-suspects-arrested-in-cologne-attacks/a-18966991

http://www.dw.com/en/a-day-into-carnival-colognes-residents-speak-up/a-19029542

Criminal proceedings have begun against 50 individuals, of whom 11 are in custody, the Cologne prosecutor Ulrich Bremer said in a statement. Most of the suspects are from Algeria, Morocco and Tunisia, he added.
"No one wants to be racist, but you also can't ignore the reality," says Schulz.>

Posted by: dh | Feb 8, 2016 4:05:11 PM | 172

@ dh | Feb 8, 2016 4:05:11 PM | 173

I am sure there were infractions that night that were actionable by the authorities and can be found reported in some press; my remarks were from what my lying eyes tell me from the videos presented. How many arrests, for what were made in Trafalgar Square, London; Champs Élysées (?), Paris, Plaza del Sol, Madrid as examples that night, all places much larger gatherings of celebrants happen that night. It is questioning those things found in the press itself that rise the questions, the story having such a long run at this time, it is unlikely answers are to be found in the press for those questions. Cui bono?

Posted by: Formerly T-Bear | Feb 8, 2016 9:56:27 PM | 173

@174 I don't live in Germany but I imagine it's a big story there. I'm very skeptical of the press myself but I thought the Deutsche Welle account was fairly calm and factual. Maybe they have an agenda, I wouldn't know.

Posted by: dh | Feb 8, 2016 10:22:46 PM | 174

This is a health scare created by the media which is in bed with Planned Parenthood. It has everything to do with abortion. Don't tell me you haven't heard calls to provide abortions in areas where they are still illegal. Plus, the baby has to be in the third trimester to even consider diagnosing microcephaly, so they are pushing late term and partial birth abortions in Catholic countries.

Posted by: Russell | Feb 9, 2016 2:43:45 PM | 175

Colombia: 3,177 Pregnant Women With Zika; No Microcephaly

BOGOTA, Colombia — Colombia's President Juan Manuel Santos said Saturday that there's no evidence Zika has caused any cases of the birth defect known as microcephaly in his country, though it has diagnosed 3,177 pregnant women with the virus.

Posted by: b | Feb 11, 2016 8:36:54 AM | 176

@ b | Feb 11, 2016 8:36:54 AM | 177

Thanks for that information. Would the following be of use?

Recently RT had a program about Cargill where to reporters went to that part of Brazil looking at Cargill operations in the north east part where vast soybean operations were taking place. It indicated much of the population had been cleared from their villages as their land had been bought and no jobs were available. This is also likely to be the same part of Brazil that was used in the cultivation of sugar and other cash crops by large slave numbers during the seventeenth, eighteenth and nineteenth centuries. Maps where the genetically modified mosquito look to be in the same area. What was not mentioned in the RT program was the ariel spraying on insecticides (herbicides?) to maintain large tracts of monoculture. Either insecticides or herbicides are entirely capable of the genetic malfunction that can cause microcephaly in the early development of the foetus when the neural system ids first forming. Reports the zika virus is a commonly encountered and mildly affecting virus are likely an attempt to create a red herring among the medically illiterate and a marketing attempt to instil doubts and questions about the cause of this outbreak of microcephaly directed away from the most likely cause - that being Monsanto's Round-up.

Posted by: Formerly T-Bear | Feb 11, 2016 9:18:39 AM | 177

Follow the $ who really makes out here is the chemical industry and w/ so many going organic and not wanting aerial pesticides what a greedy chemical company to do to get societies support to spray baby spray? Fear! that is what they did when we were being sprayed by planes for mosquitoes,lots of disease threats that didn't exist. That is what is going on here and what is at stake? We are losing our pollinators,butterflies,frogs and the right to live in a natural world w/ the creators natural balanced web of life. The summer is coming and we will all be threatened w/ the aerial application on a massive scale most likely Dibrom(Naled) A highly concentrated organophosphate nuerotoxin cholinesterase inhibitor undetectable w/out before and after levels #s known of an individuals cholinesterase levels in the body ( ,we need to get real loud and educate the population now,there is no time to waste!If you are young and healthy and do not get too high a dose your levels should rise however the young,old,unhealthy are at high risk of their levels not coming back up. You will never know what hit you as you or your loved ones health declines. The plants will absorb this chemical and when it reacts w/ water it will turn into Dichlorvous. I know this as have fought to stop the spray for several years years ago ,May the creator give us strength to guide us and stop this upcoming assault.

Posted by: chris | Feb 11, 2016 10:21:28 AM | 178

Haha, Zika virus as scapegoat then. Has to be. It's how the beast works - the best form of defence is attack.

I love how this blog is the best bullshit detector going... Awesome post and thread this. Cheers.

Posted by: MadMax2 | Feb 11, 2016 7:44:03 PM | 179

172 @174

Oh lordy, the duplicity gullibility and stupidity never stops with you racist clash of civilisations shitheads, does it?

http://www.independent.co.uk/voices/cologne-sex-assaults-muslim-rape-myths-fit-a-neo-nazi-agenda-a6872566.html

On Friday, the Cologne prosecutor Ulrich Bremer in fact told me that, of the 59 suspects pinpointed so far, just four are from war-torn countries (Syria and Iraq), only 14 are in custody, and nobody has yet been charged.

Nearly 600 hours of CCTV reveals very little, and there is no evidence whatsoever that the alleged attacks were planned in advance.


Unlike the drivel you posted above as "evidence", thats written by someone who doesnt share a surname with professional lying ZioTurd Mark Regev, so is by default a hell of a lot more trustworthy

Posted by: Told Ya | Feb 14, 2016 6:27:36 AM | 180

I scanned the many discursive and long winded responses here. I don't think this has been mentioned. NPR was talking about whether Brazil should cancel the Olympics and about how the Ziko epidemic would destroy tourism for a while. Hmmmmm. Cui Bono. The US is trying to regain control of South America. Brazil, a member of the BRICS has strong alliances with other large developing nations (including Russia and China) which strengthen its sovereignty and provide economic backing. They failed to trash the Russian Olympics. Maybe they are thinking Brazil will be a softer target?

Posted by: judy bello | Feb 16, 2016 9:51:08 PM | 181

: judy bello 181

u scan the thread but missed my post 39 !
if u'r into *conspiracy theory* make my posts a *must read*, most moa's are *coincidence theorists* !

its more than the olympics, if WHO declares zika a global threat they are now empowered to quarantine
brazil, effectively shut down the whole country !!

i heard venezuela is also hit hard by the zika, hmmm.


Posted by: denk | Feb 16, 2016 10:08:49 PM | 182

I think most of this is aimed at Brazil. Sad, but probably true.

Posted by: PeterD | Feb 23, 2016 1:02:52 PM | 183

« previous page

The comments to this entry are closed.

 

Site Meter